| Research Article |
Open Access |
|
| Comparative Genomic and Proteomic Phylogenetic Analysis of Indian Isolate of Partial Coat Protein Gene Sequence of Zucchini Yellow Mosaic Virus (ZYMV) Using Data Mining |
| Neha Sharma*, Satya Vrat Bhardwaj, Anju Sharma, Manica Tomar, Rajinder Kaur, Pritam Dass Thakur and Anil Handa |
| Dr Y S Parmar University of Horticulture and Forestry, Nauni, Solan, Himachal Pradesh, India |
| *Corresponding author: |
Neha Sharma
Dr Y S Parmar University of
Horticulture and Forestry
Nauni, Solan, Himachal Pradesh, India
E-mail:
angelnbt@gmail.com |
|
| |
| Received July 08, 2012; Accepted August 20, 2012; Published August 22, 2012 |
| |
| Citation: Sharma N, Bhardwaj SV, Sharma A, Tomar M, Kaur R, et al. (2012)
Comparative Genomic and Proteomic Phylogenetic Analysis of Indian Isolate of
Partial Coat Protein Gene Sequence of Zucchini Yellow Mosaic Virus (ZYMV)
Using Data Mining. J Proteomics Bioinform 5: 196-203. doi:10.4172/jpb.1000235 |
| |
| Copyright: © 2012 Sharma N, et al. This is an open-access article distributed under
the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and
source are credited. |
| |
| Abstract |
| |
| A viral disease was identified on summer squash (Cucurbita pepo L.) plants in the hill state of Himachal Pradesh
located in the North Western Himalayan regions, showing symptoms like mosaic, yellowing, shoe stringing of
leaves and stunting of plants and infection at early stage of crop could cause as much as 94 per cent reduction
of marketable fruits of summer squash. In the present study the causal virus was identified and characterized on
the basis of ELISA, RT-PCR and Phylogeny. Partial CP gene was amplified and sequenced. For phylogenetic
studies 67 nucleotide and 67 polyprotein sequences of ZYMV belonging to different countries were retrieved from
NCBI. Phylogenetic analysis based on nucleotide and protein sequences of each country using Maximum Likelihood
(ML), Neighbor Joining (NJ), Maximum Parsimony (MP) and Unweighted Pair Group Method of Arithmetic Averages
(UPGMA) methods were achieved via phylip 3.68 and EXOMETM HORIZON, which revealed 91% similarity of the
test virus nucleotide sequence with USA ZYMV CP sequence (D13914) and 75.9% similarity with partial polyprotein
sequence of Japan (BAE75935). |
| |
| Keywords |
| |
| ZYMV; Phylogenetic trees; Phylograms; Nucleotide
sequence; Polyprotein sequence; RT-PCR; CP gene sequence; Data
mining |
| |
| Introduction |
| |
| Crops belonging to family cucurbitaceae are generally known as
cucurbits. As a group, cucurbits occupy largest area in India and in other
tropical countries amongst vegetable crops. Out of all cucurbitaceous
crops, summer squash is one of the important crops because it is one
of the earliest vegetables reaching markets of India. Amongst different
plant pathogens, viral infections are responsible for causing great losses
to this crop. In cucurbit crops, viruses belonging to Potyvirus genus
have severely caused economical damage all over the world [1]. In
particular, Zucchini Yellow Mosaic Virus (ZYMV), a member of genus
Potyvirus in the family Potyviridae, was subsequently one of the most
damaging virus causing epidemics in commercial cucurbits worldwide
[2]. In Korea, the disease caused by ZYMV has been considered one
of the major limiting factors for production of cucurbits [3,4]. In this
study the partial coat protein gene sequence of ZYMV of Indian isolate
of North Western Himalayan region was determined and phylogenetic
analysis of the test sequence at both genomic and proteomic level was
carried out to gain insight of the evolutionary pattern of Zucchini
yellow mosaic virus and hence phylograms and phylogenetic trees
were constructed for all 14 countries viz, Australia, Austria, California,
China, France, Hungary, India, Israel, Japan, Korea, Poland, Singapore,
Taiwan and USA using phylip 3.68 and EXOMETM HORIZON
respectively. The present studies on phylogenetic analysis with
other countries isolates have been carried out to suggest world wide
distribution of ZYMV and by tracing its phylogeny management of
the disease may be understood. This work represents the first detailed
phylogenetic study ever conducted with well explained flowcharts for
methods used for constructing 64 phylograms and 64 phylogenetic
trees. |
| |
| Materials and Methods |
| |
| Survey and collection of samples |
| |
| An extensive survey of different summer squash (Cucurbita pepo L.) growing in localities of Himachal Pradesh was conducted. Tender
leaves of summer squash plants showing symptoms of ZYMV were
collected from the hill state of Himachal Pradesh located in North
Western Himalayan regions. |
| |
| Maintenance of the virus isolate |
| |
| The virus cultures were maintained on healthy seedlings of summer
squash variety Australian Dark Green by mechanical sap inoculation
under insect proof glass house conditions. |
| |
| Enzyme Linked Immunosorbent Assay (ELISA) |
| |
| ZYMV specific antibodies along with alkaline phosphatase linked
antibodies produced from (BIOREBA-AG Switzerland) were used for
ELISA and protocols of suppliers of ELISA kits were used (Figure 1).
The positive and negative controls were also provided by the antibody
suppliers (BIOREBA-AG Switzerland). |
| |
| RNA isolation |
| |
| Total RNA from virus infected summer squash leaves was isolated
using RNAeasy plant Mini Kit (Qiagen). RNA isolation was also tried
at healthy control plant. |
| |
| Reverse Transcription-Polymerase Chain Reaction (RTPCR)
and PCR |
| |
| The above isolated RNA was used as a template for cDNA synthesis by using specific oligonucleotide primer p9502 shown in Table 1.
For the first strand cDNA synthesis RT-PCR was carried out and for
further amplification of cDNA, PCR was carried out in a thermal
cycler (Applied Biosystem, USA) using specific primers (Table 1).
Components of RT-PCR and PCR were standardized (Table 2) and so
do the thermal profile and no. of cycles. |
| |
|
Table 1: Primers used for PCR amplification and Sequencing. |
|
| |
|
Table 2: Standardization of RT-PCR and PCR. |
|
| |
| Sequencing and translation of the sequenced PCR product |
| |
| Sequencing using both reverse and forward primers was carried out
[5] and the partial coat protein sequence obtained has been submitted
to NCBI Database and also the sequence was kept as such for genomic
studies at nucleotide level and was also translated to protein using
Expert Protein Analysis System (EXPASY) tool for proteomic studies. |
| |
| Importing of Sequences |
| |
| Sequence selection |
| |
| Both nucleotide and protein sequences of coat protein gene
of ZYMV were retrieved from National Centre for Biotechnology
Information (NCBI) (http://www.ncbi.nlm.nih.gov/) (Table 3). |
| |
|
Table 3: List of Nucleotide and Protein sequences retrieved from NCBI. |
|
| |
| These nucleotide sequences and protein sequences given in Table
3 were later used with test sequence for multiple sequence alignment,
phylogenetic analysis using various online/offline bioinformatic tools. |
| |
| Conversion of selected sequences into FASTA format |
| |
| All 67 coat protein nucleotide and protein sequences obtained
from all over the world in GenBank format were converted into FASTA
format [6]. These ‘FASTA’ formatted sequences were then stored
country-wise in separate notepads. |
| |
| Sequence alignment |
| |
| During present investigations, multiple sequence alignment
of nucleotide and protein sequences of ZYMV and other 67 ZYMV
isolates retrieved from NCBI database, was carried out. Multiple
sequence alignment was performed using CLUSTAL W program [7]. |
| |
| Phylogenetic analysis |
| |
| For Phylograms phylip 3.68 Software was used and for phylogenetic trees EXOME™ was used. Test virus nucleotide sequence and
polyprotein sequence analysed countrywise with different sequences
retrieved from NCBI using various popular methods like Maximum
Likelihood (ML), Neighbor Joining (NJ), Maximum Parsimony
(MP) and Unweighted Pair Group Method of Arithmetic Averages
(UPGMA) and finally trees were generated and analysed (Figure 2). |
| |
|
| |
|
| |
| Results |
| |
| Culture identification and collection |
| |
| Under field conditions, summer squash plants infected with
ZYMV develop a variety of symptoms. These symptoms vary from
mild to severe mosaic, green blisters on leaves, vein clearing, and shoe
stringing of leaves (Figure 3). |
| |
|
Figure 3 Deformed leaf showing blisters and vein clearing symptoms on Summer Squash (Cucurbita pepo L.). |
|
| |
| For culture collection, survey of various summer squash growing
localities of H.P. was conducted. |
| |
| Mechanical transmission |
| |
| Indicator plant Chenopodium amaranticolor Coste and Reyn was
also used to indicate presence of the test virus by observing the lesions. |
| |
| Symptomatlogy |
| |
| The first manifestation of the disease on the inoculated plants was
observed after 16-18 days of inoculation in the form of vein clearing
on the younger leaves. Later, mottling and mild mosaic symptoms
were exhibited by the infected plants. As the infestation progressed,
leaf lamina was drastically reduced in both shape and size. Leaves
were deformed with dark green blisters and distorted mid ribs. Virus infection caused shoe stringing and overall growth reduction in
comparison to their healthy counterparts. |
| |
|
| Serological detection |
| |
| Infected leaves of summer squash showing prominent symptoms
were subjected to serological indexing and the samples collected from
hill state of H.P. produced prominent yellow colour and which was also
confirmed by the OD value obtained and as the OD value was so near
to the positive control OD it confirmed severe infection of ZYMV in
the samples drawn from District Una (HP) (Tables 4 and 5). |
| |
|
Table 4: DAC ELISA results for detection of potyvirus using potyvirus group specific immunoglobulins (O.D value at A405 nm). |
|
| |
|
Table 5: DAS ELISA results against detection of Zucchini yellow mosaic virus using ZYMV specific immunoglobulins (O.D value at A405 nm). |
|
| |
| RNA isolation and molecular detection of the virus using RTPCR
and amplification of cDNA |
| |
| Results of serology indicated presence of test virus and concentration
of the virus was also high. So, infected and healthy plants were then
used for RNA isolation. The isolated RNA was reverse transcribed into
cDNA. This RT-PCR was then followed by amplification of cDNA with
PCR. The amplified product obtained was of 700 bp and on using this
PCR product along with forward and reverse primer for sequencing
the sequence so obtained were 154 nucleotides (Sequence in FASTA
Format) |
| |
| Sequence |
| |
| GCTACGAAACCTACGGGATAGCAGTCTCACACTTGACGCTTTCGATTTCTATGAAGTCAATT
CTACAACTCCTGAAAGAGCCCGTGTAGCTGTAGCGCAGATGAAAGCAGCAGCTCTTAGCAAT
GTTTCTTCAAGGCGGTTTGGCATAGGTGAT |
| |
| Translation of the test sequence |
| |
| The sequence was translated into its amino acid residues using
protein translator tool at Target Assisted Iterative Screening (TAIS)
network. Analysis of amino acid sequence showed a longest open
reading frame (5’-3’) of 51 amino acids with Methionine in between.
(Protein Product). |
| |
| Protein sequence |
| |
| 5'-3' L R N L R D S S L T L D A F D F Y E V N S T T P E R A R V A
V A Q Met K A A A L S N V S S R R F G I G D |
| |
| Multiple sequence alignment |
| |
| Multiple sequence alignment of selected nucleotide and protein
sequences of zucchini yellow mosaic virus with that of Una (Indian)
isolate was performed using CLUSTAL W program [7] available online
at European Bioinformatics Institute (EBI) (http://www.ebi.ac.uk/) and similarly, country wise CLUSTAL W along with query nucleotide and
protein sequence was also performed and these CLUSTAL W outputs
were then used in (phylip 3.68 and EXOMETM software) bioinformatics
tools for constructing phylograms and phylogenetic trees. |
| |
| Pairwise percentage similarity score matrices were also drawn for
each of the 67 nucleotide and protein sequences when compared with
test isolate from Una (India). This data is arranged country wise in
tabular form: (Table 6). |
| |
|
Table 6: Nucleotide and protein sequences alignment data generated for different countries by Clustal W tool. |
|
| |
| The pairwise similarity score of 67 nucleotide sequences with test
sequence elucidates that sequences from Australia, Austria, China,
Hungary, Japan, Korea, Taiwan and Varied countries were 75%, 77%,
75-77%, 77%, 77%, 67-77%, 75-77%, 75-77% respectively in case of
proteins (Table 6). |
| |
| Phylogenetic Analysis |
| |
| To trace out the evolutionary patterns of the test virus and to
find out relationship of the same with other selected sequences at
NCBI (Tables 7 and 8) (Figure 4 (included as supplementary data))
phylograms and phylogenetic trees were constructed using Maximum
Likelihood (ML), Maximum Parsimony (MP), Neighbor Joining
(NJ) and Unweighted pair group method of mathematical averages
(UPGMA) methods using phylip 3.68 and EXOME™ respectively. |
| |
|
Table 7: Phylograms and Phylogenetic trees analysis data of nucleotide sequences of ZYMV (with the test sequence) for different countries using Phylip 3.68 and
EXOME™. |
|
| |
|
Table 8: Phylograms and Phylogenetic trees analysis data of protein sequences
of ZYMV (with test protein) for different countries using Phylip 3.68 and EXOME™. |
|
| |
| Phylograms and phylogenetic trees analysis of nucleotides
and proteins |
| |
| Australia: A total of 5 nucleotide and 5 protein sequences selected
from Australian sequences were put to analysis with the test virus, the
trees were drawn and the results using different methods are being
briefly described |
| |
| • The test virus found sequence similarity with DQ925447 in
all the phylograms and phylogenetic trees constructed for test
ZYMV sequences from Australia |
| |
| • The test virus found protein sequence similarity with ABL09422
in all the phylograms and phylogenetic trees constructed |
| |
| Austria: A total of 9 nucleotide and 9 protein sequences selected
from Austrian sequences were put to analysis with the test virus, the
trees were drawn and the results using different methods are being
briefly described |
| |
| • The test virus found sequence similarity with AJ420020 in
all the phylograms and phylogenetic trees constructed for
Austrian isolates |
| |
| • The test virus found protein sequence similarity with CAD12315
and CAD12316 in all the phylograms and phylogenetic trees
constructed for Austrian isolates |
| |
| China: A total of 20 nucleotide and 20 protein sequences selected
from Chinese sequences were put to analysis with the test virus, the
trees were drawn and the results using different methods are being
briefly described |
| |
| • The test virus found least sequence similarity only with
AJ316229 out of all the phylograms and phylogenetic trees
constructed for Chinese isolates |
| |
| • The test virus found least protein sequence similarity with some
protein sequences from all the phylograms and phylogenetic
trees constructed for Chinese isolates |
| |
| Hungary: A total of 4 nucleotide and 4 protein sequences selected
from Hungarian sequences were put to analysis with the test virus, the
trees were drawn and the results using different methods are being
briefly described |
| |
| • The Hungarian sequences found around 60% sequence similarity with the test sequence in all the phylograms and
phylogenetic trees constructed for Hungarian isolates |
| |
| • The test virus found protein sequence similarity with
CAD31036, CAD31056 protein sequences in all the phylograms
and phylogenetic trees constructed for Hungarian isolates |
| |
| Japan: A total of 6 nucleotide and 6 protein sequences selected
from Japanese sequences were put to analysis with the test virus, the
trees were drawn and the results using different methods are being
briefly described |
| |
| • The test virus found sequence similarity with AB188115 and
AB188116 in all phylograms and phylogenetic trees constructed
for Japanese isolates |
| |
| • The test virus found protein sequence similarity with
BAE75935, BAE75934, and BAD74201 protein sequences
in all the phylograms and phylogenetic trees constructed for
Japanese isolates |
| |
| Korea: A total of 5 nucleotide and 5 protein sequences selected
from Korean sequences were put to analysis with the test virus, the
trees were drawn and the results using different methods are being
briefly described |
| |
| • The test virus found sequence similarity with AJ429071 out
of all the phylograms and phylogenetic trees constructed for
Korean isolates |
| |
| • The test virus found protein sequence similarity with
CAD22062, AAQ17215 and AAQ17216 protein sequences in
the phylograms and phylogenetic trees constructed for Korean
isolates |
| |
| Taiwan: 8 nucleotide and 8 protein sequences of CP ZYMV
selected from Taiwan and were put to analysis with the test virus, the
trees were drawn are being briefly described |
| |
| • The test virus found sequence similarity with AF127933 in
all the phylograms and phylogenetic trees constructed for
Taiwanese sequences |
| |
| • The test virus found less protein sequence similarity with
AAD44688 protein sequence as revealed from all the
phylograms and phylogenetic trees constructed for Taiwanese
isolates 10 nucleotide and 10 protein CP gene sequences of
ZYMV isolates of different countries were studied to analyze
with the test virus, the trees were drawn and the results using
different methods are being briefly described |
| |
| Among the various sequences of varied countries, sequences from
California, France, India, Israel, Poland, South Africa, Singapore and
USA were studied. |
| |
| • The test virus found maximum sequence similarity with D13914
in all the phylograms and phylogenetic trees constructed |
| |
| • The test virus found protein sequence similarity with
ABM65098 and ABI97984 protein sequences |
| |
| Discussion |
| |
| In the present studies, partial CP gene sequence of Una (Indian)
isolate of ZYMV compared with other 67 isolates of ZYMV at both
genomic and proteomic level to see its evolutionary behavior. |
| |
| Viral cultures under present investigations were selected on
visual symptoms. The zucchini yellow mosaic virus has been known
to produce symptoms like vein clearing, yellow mosaic, blistering and
shoestringing of leaves, fruit and seed deformations and stunting of
plants [8]. |
| |
| DAS-ELISA confirmed the presence of ZYMV in the samples
collected. In literature, there are numerous reports (Chalam et al.,
Auger et al., Malik et al. and Pospieszny et al.) in which DAS-ELISA
has been used to confirm presence of ZYMV and other viruses in the
infected plant samples [9-12]. |
| |
| There have been many reports of simple and rapid techniques to
detect plant viruses using RT-PCR. Lately, in 2007, detection of ZYMV
using RT-PCR was carried out in C. sativus L. and Cucumis melo L. in
Poland. Pospiezny et al. and Auger et al. identified a strain of ZYMV on
squash by means of DAS ELISA and PCR using ZYMV specific primers
ZY-2 and ZY-3 and a segment of 1186 bp was amplified and sequenced
[10,12]. |
| |
| Prieto et al. had also sequenced a fragment of 395 bp in length from
the 3’ portion of CP gene of Chilean isolate of ZYMV. In the present
case however only 154 nucleotide long DNA was amplified confirming
only partial amplification and sequencing of the CP gene [19]. |
| |
| Multiple sequence alignment of the test nucleotide and protein
sequence of test isolate with other 67 isolates of ZYMV imported
from NCBI revealed that alignment score was highest for USA among
varied countries and lowest for China in case of nucleotides whereas it
was lowest for Korea in case of proteins. Alignment score for Indian
sequence of ZYMV was 86% and 77% in case of nucleotides and
proteins, respectively on using Clustal W. |
| |
| Shukla and Ward predicted amino acid sequence of ZYMV
coat protein of USA and compared with the published amino acid
sequences of other potyviral coat proteins [20]. Overall homology
ranged from 47.5 to 67.1%. This was in agreement with 38 to 71% range
of homologies observed among distinct potyviruses; while different
strains of the same virus showed greater than 90% homologous
behavior. |
| |
| In present studies phylogenetic relationship of the test isolate with
67 isolates of ZYMV retrieved from NCBI database were determined
at both nucleotide and protein levels by applying four methods viz.,
the UPGMA [21], the neighbour joining [22], the maximum likelihood
[23,24] and the maximum parsimony using Phylip 3.68 and EXOME™
software [25]. |
| |
| Present phylogenetic analysis at nucleotide level indicated that
DQ925447 (Australia), AJ420020 (Austria) with significant bootstrap, AJ316229 (China), AJ459956 (Hungary) with low bootstrap,
(AB188116 and AB188115) Japan, AF127933 (Taiwan), D13914 and
DQ978272 (USA among varied countries) showed close proximity
with the test partial CP of ZYMV. While at protein level ABL09422
(Australia), CAD12315 and CAD12316 (Austria), CAD31036
(Hungary), BAE75935 and BAE75934 (Japan), AAD44688 (Taiwan)
and ABM65098 (Poland among varied countries) showed maximum
proximity at protein level. Studies conducted by Lin et al., Pfosser and
Baumann, and Zhao et al. supported present investigations [13,16,26]. |
| |
| Auger et al. identified a strain of ZYMV on squash and phylogenetic
analysis of this strain with other isolates revealed its 98% identity with
Connecticut and California strains [10]. |
| |
| Conclusion |
| |
| In Conclusion, it was found that the test virus showed maximum
similarity with the USA isolate (D13914) of ZYMV. It is however
indicating that the virus may have been imported into India from USA. |
| |
|
| References |
| |
- Hull R (2002) Matthew’s Plant Virology. (4thedn). Academic Press, USA.
- Lisa V, Lecoq H (1984) Zucchini yellow mosaic virus. CMI/AAB Descriptions of Plant Viruses, No.282 Kew, Surrey.
- Kwon SW, Kim MS, Choi HS, Kim KH (2005) Biological characteristics and nucleotide sequences of three Korean isolates of Zucchini yellow mosaic virus. J Gen Plant Pathol 71: 80-85.
- Yoon JY, Choi JK (1998) Nucleotide sequence of 3-terminal region of Zucchini yellow mosaic virus (cucumber isolate) RNA. Korean J Plant Pathol 14: 23-27.
- Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci U S A 74: 5463-5467.
- Pearson WR (2000) Flexible sequence similarity searching with the FASTA3 program package. Methods Mol Biol 132: 185-219.
- Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673-4680.
- Brunt AA, Crabtree K, Dallwitz MJ, Gibbs AJ, Watson L (eds.) (1996) Viruses of plants: Description and lists from the VIDE Database. University Press, Camabridge. 1484p.
- Chalam VC, Singh B, Rathi YPS, Khetarapal RK (2003) Occurrence of zucchini yellow mosaic Dis. on summer squash (Cucurbita pepo L.) a new record from India. J Mycol Plant Pathol 33: 284-285.
- Auger J, Martinez C, Esterio M, Prieto H (2004) Identification and transmission of strains of 24 zucchini yellow mosaic virus (ZYMV) causal agents of fruit deformation in squash (Cucurbita maxima) in Chile. Fitopatologia39: 133-143.
- Malik AH, Mansoor S, Iram S, Briddon RW, Zafar Y (2006) A severe outbreak of melon yellow mosaic Dis. caused by Zucchini yellow mosaic virus in Pakistan. Plant Pathol 55: 285.
- Pospieszny H, Hasiow B, Borodynko N (2007) A polish isolate of zucchini yellow mosaic virus from zucchini is distinct from other European isolates. Plant Dis 91: 639.
- Lin SS, Hou RF, Yeh SD (2001) Complete genome sequence and genetic organization of a Taiwan isolate of Zuccini yellow mosaic virus. Botanical Bulletin of Academia Sinica 42: 243-250.
- Thomson KG, Dietzgen RG, Gibbs AJ, Tang YC, Liesack W, et al. (1995) Identification of zucchini yellow mosaic potyvirus by RT-PCR and analysis of sequence variability. J Virol Methods55: 83-96.
- Lin S, Kim M, Choi H, Kim K (1998) Characterization of ZYMV isolate from Taiwan. J Gen Plant pathol 71: 82-85.
- Pfosser MF, Baumann H (2002) Phylogeny and geographical differentiation of zucchini yellow mosaic virus isolates (Potyviridae) based on molecular analysis of the coat protein and part of the cytoplasmic inclusion protein genes. Arch Virol 147: 1599-1609.
- Choi SK, Yoon JY, Sohn SH (2007) Analysis of complete genome sequence of Zucchini yellow mosaic virus strain A isolated from Hollyhock. Plant Pathol J23: 245-250.
- Sharma M (2009) Characterization and identification of viruses infecting summer squash. MSc. Thesis. Dr Y. S. Parmar University of Horticulture and Forestry, Nauni, Solan (HP), India.
- Prieto H, Bruna A, Hinrichsen P, Munoz C (2001) Isolation and molecular characterization of a Chilean isolate of zucchini yellow mosaic virus. Plant Dis 85: 644-648.
- Shukla DD, Ward CW (1989) Identification and classification of potyviruses on the basis of coat protein sequence data and serology. Arch Virol106: 171-200.
- Sneath PHA, Sokal RR (1963) Principles of Numerical taxonomy. Freeman, San Francisco, California.
- Felsenstein J (1993) PHYLIP- (Phylogeny inference package), version 3.5. Department of Genetics, University of Washington, Seattle.
- Strimmer K, von Haeseler A (1996) Quartet puzzling: a quartet maximum likelihood method for reconstructing tree topologies. Mol Biol Evol13: 964-969.
- Strimmer K, Goldman N, von Haeseler A (1997) Bayesian probabilities and quartet puzzling. Mol Biol Evol14: 210.
- Swofford DL (1998) PAUP.Phylogenetic Analysis Using Parsimony, Version 4. Sinauer Associates. Sunderland, MA.
- Zhao MF, Chen J, Zheno HY, Adams MJ, Chen JP (2003) Molecular analysis of Zucchini yellow mosaic virus isolates from Hangzhou, China. J Phytopathology 151: 307-311.
|
| |
| |
