Virology & Mycology Infectious Diseases
 
Untitled Document
   Publications A-Z
A
»Accounting & Marketing
» Addiction Research & Therapy
»Advances in Automobile Engineering
»Advances in Pharmacoepidemiology & Drug Safety
»Advances in Robotics & Automation
»Aeronautics & Aerospace Engineering
»Agrotechnology
»AIDS & Clinical Research
»Allergy & Therapy
»Air & Water borne Diseases
»Alzheimers Disease & Parkinsonism
»Analytical & Bioanalytical Techniques
»Anaplastology
»Anatomy & Physiology
»Andrology-Open Access
»Anesthesia & Clinical Research
»Antivirals & Antiretrovirals
»Applied & Computational Mathematics
»Applied Mechanical Engineering
»Aquaculture Research & Development
»Architectural Engineering Technology
»Arthritis
»Astrophysics & Aerospace technology
»Autacoids
»Autism-Open Access
  
B
»Bacteriology & Parasitology
»Bioanalysis & Biomedicine
»Biochemistry and Analytical Biochemistry
»Biochemistry & Pharmacology: Open Access
»Biochips & Tissue Chips
»Bioenergetics: Open Access
»Bioengineering & Biomedical Science
»Bioequivalence & Bioavailability
»Biofertilizers & Biopesticides
»Biometrics & Biostatistics
»Biomolecules
»Biochemistry & Physiology: Open Access
»Bioprocessing & Biotechniques
»Bioremediation & Biodegradation
»Biosafety
»Biosensors & Bioelectronics
»Biotechnology & Biomaterials
»Bioterrorism & Biodefense
»Blood Disorders & Transfusion
»Blood & Lymph
»Brain Disorders & Therapy
»Briefing in Intellectual Property Rights
»Business and Financial Affairs
  
C
»Cancer Science & Therapy
»Carcinogenesis & Mutagenesis
»Cell and Developmental Biology
»Cell Science & Therapy
»Chemical Engineering & Process Technology
»Chemotherapy: Open Access
»Chromatography & Separation Techniques
»Civil & Environmental Engineering
»Civil & Legal Sciences
»Clinical & Cellular Immunology
»Clinical Case Reports
»Clinical & Experimental Cardiology
»Clinical & Experimental Dermatology Research
»Clinical & Experimental Ophthalmology
»Clinical & Experimental Pathology
»Clinical & Experimental Pharmacology
»Clinical Pharmacology & Biopharmaceutics
»Clinical Research & Bioethics
»Clinical Toxicology
»Clinical Trials
»Cloning & Transgenesis
»Communicable & Noncommunicable Diseases
»Community Medicine & Health Education
»Computer Science & Systems Biology
»Cytology & Histology
D
»Data Mining in Genomics & Proteomics
»Defense Management
»Dentistry
»Depression and Anxiety
»Diabetes & Metabolism
»Drug Designing
»Drug Metabolism & Toxicology
  
E
»Earth Science & Climatic Change
»Ecosystem & Ecography
»Endocrinology & Metabolic Syndrome
»Entomology, Ornithology & Herpetology
»Environmental & Analytical Toxicology
»Epidemiology: Open Access
»Emergency Medicine: Open Access
»Ergonomics
»Electrical & Electronics
»Enzyme Engineering
»Entrepreneurship & Organization Management
  
F
»Fermentation Technology
»Fertilization : In Vitro
»Food Processing & Technology
»Forensic Research
»Forest Research: Open Access
»Fungal Genomics & Biology
  
G
»Gastrointestinal & Digestive System
»Genetic Syndromes & Gene Therapy
»Glycobiology
»Glycomics & Lipidomics
»Gynecology& Obstetrics
»Geography & Natural Disasters
»Geology & Geosciences
»Geophysics & Remote Sensing
»Gerontology & Geriatric Research
  
H
»Hair : Therapy & Transplantation
»Health & Medical Informatics
»Hereditary Genetics
»Homeopathy & Ayurvedic Medicine
»Hotel & Business Management
»Human Genetics & Embryology
»Hydrology: Current Research
»Hypertension- Open Access
  
I
»Industrial Engineering & Management
»Irrigation and Drainage Systems Engineering
»Information Technology & Software
Engineering
»Internal Medicine
  
L
»Liver
  
M
»Marine Science: Research & Development
»Mass Communication & Journalism
»Material Sciences & Engineering
»Medicinal Chemistry
»Medical Advancements in Genetic Engineering
»Medicinal & Aromatic Plants
»Medical Diagnostic Methods
»Medical Microbiology & Diagnosis
»Medical & Surgical Urology
»Membrane Science & Technology
»Metabolic Syndrome
»Metabolomics:Open Access
»Microbial & Biochemical Technology
»Molecular Biology
»Molecular Biomarkers & Diagnosis
»Molecular Imaging & Dynamics
»Mycobacterial Diseases
N
»Nanomedicine & Biotherapeutic Discovery
»Nanomedicine & Nanotechnology
»Neonatal Biology
»Nephrology & Therapeutics
»Neurology & Neurophysiology
»Novel Physiotherapies
»Nuclear Energy & Power Generation
Technologies
»Nuclear Medicine & Radiation Therapy
»Nutrition & Food Sciences
»Nutritional Disorders & Therapy
»Nursing & Care
  
O
»Obesity & Weight loss Therapy
»Outlook on Developing Drugs: Open Access
»Organ Biology
»Organic Chemistry: Current Research
»Orthopedic & Muscular System: Current Research
»Otolaryngology
  
P
»Pain & Relief
»Palliative Care & Medicine
»Pancreatic Disorders & Therapy
»Pediatrics & Therapeutics
»Petroleum & Environmental Biotechnology
»Pharmaceutica Analytica Acta
»Pharmaceutical Regulatory Affairs: Open Access
»Pharmaceutics & Drug Delivery Research
»Pharmacogenomics & Pharmacoproteomics
»Physical Chemistry & Biophysics
»Plant Pathology & Microbiology
»Powder Metallurgy & Mining
»Primatology
»Primary Health Care: Open Access
»Proteomics & Bioinformatics
»Psychology & Psychotherapy
»Pulmonary & Respiratory Medicine
  
R
»Radiology: Open Access
»rDNA Technology
»Reproductive System & Sexual Disorders
»Rheumatology: Current Research
  
S
» Single Cell Genomics & Proteomics
»Sleep Disorders & Therapy
»Social & Economical Issues of Biotechnology
»Socialomics
»Sports Medicine & Doping Studies
»Spine
»Stem Cell Research & Therapy
»Steroids & Hormonal Science
»Stock & Forex Trading
»Surgery: Current Research
  
T
»Telecommunications System & Management
»Textile Science & Engineering
»Thermodynamics & Catalysis
»Thyroid Disorders & Therapy
»Tissue Science & Engineering
»Translational Medicine
»Transplantation Technologies & Research
»Trauma & Treatment
»Tourism & Hospitality
  
V
»Vaccines & Vaccination
»Veterinary Science & Technology
»Virology & Mycology
»Vitamins & Trace Elements
  
W
»Women's Health Care
  
Y
»Yoga & Physical Therapy
 
   Browse by Subjects
Clinical
»Clinical & Experimental Pharmacology
»Forensic Research
»Cell Science & Therapy
»Stem Cell Research & Therapy
»Cancer Science & Therapy
»Carcinogenesis & Mutagenesis
»Cytology & Histology
»AIDS & Clinical Research
»Anesthesia & Clinical Research
»Transplantation Technologies & Research
»Clinical Research & Bioethics
»Clinical & Cellular Immunology
»Clinical & Experimental Cardiology
»Clinical & Experimental Dermatology Research
»Clinical & Experimental Ophthalmology
»Neurology & Neurophysiology
»Clinical & Experimental Pathology
»Pulmonary & Respiratory Medicine
»Clinical Toxicology
  
Pharmaceutical Sciences
»Vaccines & Vaccination
»Antivirals & Antiretrovirals
»Bioanalysis & Biomedicine
»Drug Metabolism & Toxicology
»Bioequivalence & Bioavailability
»Pharmaceutica Analytica Acta
»Pharmaceutics & Drug Delivery Research
»Clinical Pharmacology & Biopharmaceutics
»Outlook on Developing Drugs: Open Access
»Pharmacoepidemiology & Drug Safety
»Pharmaceutical Regulatory Affairs: Open Access
  
Chemistry
»Thermodynamics & Catalysis
»Physical Chemistry & Biophysics
»Organic Chemistry
»Chromatography & Separation Techniques
»Analytical & Bioanalytical Techniques
»Medicinal Chemistry
  
Environmental
»Earth Science & Climatic Change
»Environmental & Analytical Toxicology
»Aquaculture Research & Development
»Hydrology: Current Research
»Petroleum & Environmental Biotechnology
»Ecosystem & Ecography
  
Omics
»Pharmacogenomics & Pharmacoproteomics
»Data Mining in Genomics & Proteomics
»Proteomics & Bioinformatics
»Computer Science & Systems Biology
»Health & Medical Informatics
»Glycomics & Lipidomics
»Metabolomics:Open Access
  
Life Sciences
»Agrotechnology
»Marine Science: Research & Development
»Veterinary Science & Technology
»Plant Pathology & Microbiology
»Nutrition & Food Sciences
»Bioremediation & Biodegradation
»Biometrics & Biostatistics
»Bioengineering & Biomedical Science
»Microbial & Biochemical Technology
»Bioterrorism & Biodefense
»Biofertilizers & Biopesticides
»Social & Economical Issues of Biotechnology
»Biosensors & Bioelectronics
»Nanomedicine & Biotherapeutic Discovery
»Biochips & Tissue Chips
»Molecular Imaging & Dynamics
»Yoga & Physical Therapyy
»Tissue Science & Engineering
»Biotechnology & Biomaterials
»Biochemistry and Analytical Biochemistry
»Nanomedicine & Nanotechnology
»Membrane Science & Technology
»Bacteriology & Parasitology
»Enzyme Engineering
»rDNA Technology
»Cell and Developmental Biology
»Fermentation Technology
»Chemotherapy
»Biochemistry & Physiology
»Biomolecules
»Biochemistry & Physiology: Open Access
»Biochemical Pharmacology
»Bioenergetics
»Forest Research
»Fungal Genomics & Biology
»Medical Advancements in Genetic Engineering
»Biosafety
»Medicinal & Aromatic Plants
» Single Cell Genomics & Proteomics
»Vitamins & Trace Elements
»Women's Health Care
»Primatology
  
Engineering
»Advances in Automobile Engineering
»Advances in Robotics & Automation
»Aeronautics & Aerospace Engineering
»Applied Mechanical Engineering
»Architectural Engineering Technology
»Bioprocessing & Biotechniques
»Chemical Engineering & Process Technology
»Civil & Environmental Engineering
»Electrical & Electronics
»Food Processing & Technology
»Geology and Geosciences
»Geophysics & Remote sensing
»Industrial Engineering & Management
»Information Technology & Software
Engineering
»Irrigation and Drainage Systems Engineering
»Material Sciences& Engineering
»Powder Metallurgy & Mining
»Telecommunications System & Management
»Textile Science & Engineering
  
Medical Sciences
»Genetic Syndromes & Gene Therapy
»Steroids & Hormonal Science
»Virology & Mycology
»Communicable & Noncommunicable Diseases
»Molecular Biomarkers & Diagnosis
»Psychology & Psychotherapy
»Nuclear Medicine & Radiation Therapy
»Alzheimers Disease & Parkinsonism
»Dentistry
»Pediatrics & Therapeutics
»Rheumatology: Current Research
»Hereditary Genetics
»Reproductive System & Sexual Disorders
»Addiction Research & Therapy
»Allergy & Therapy
»Diabetes & Metabolism
»Blood Disorders & Transfusion
»Endocrinology & Metabolic Syndrome
»Nutritional Disorders & Therapy
»Medical Microbiology & Diagnosis
»Human Genetics & Embryology
»Gastrointestinal & Digestive System
»Otolaryngology
»Anatomy & Physiology
»Autacoids
»Sports Medicine & Doping Studies
»Nephrology & Therapeutics
»Community Medicine & Health Education
»Translational Medicine
»Entomology, Ornithology & Herpetology
»Orthopedic & Muscular System
»Epidemiology: Open Access
»Gynecology& Obstetrics
»Mycobacterial Diseases
»Anaplastology
»Surgery: Current Research
»Radiology: Current Research
»Internal Medicine
»Blood & Lymph
»Emergency Medicine
»Fertilization : In Vitro
»Palliative Care & Medicine
»Glycobiology
»Ergonomics
»Liver
»Neonatal Biology
»Medical Diagnostic Methods
»Hair: Therapy & Transplantation
»gerontology & Geriatrics Research
»Andrology
»Clinical Case Reports
»Spine
»Pain & Relief
»Depression and Anxiety
»Obesity & Weight loss Therapy
»Sleep Disorders & Therapy
»Nursing & Care
»Trauma & Treatment
»Primary Health Care: Open Access
»Clinical Trials
»Homeopathy & Ayurvedic Medicine
»Brain Disorders & Therapy
»Pancreatic Disorders & Therapy
»Metabolic Syndrome
»Novel Physiotherapies
»Thyroid Disorders & Therapy
»Air & Water borne Diseases
»Drug Designing
»Molecular Biology
»Cloning & Transgenesis
»Hypertension-Open Access
»Organ Biology
»Arthritis
 
Management
»Accounting & Marketing
»Business and Financial Affairs
»Civil & Legal Sciences
»Defense Management
»Entrepreneurship& Organization Management
»Hotel & Business Management
»Industrial Engineering & Management
»Mass Communication & Journalism
»Stock & Forex Trading
» Socialomics
»Tourism & Hospitality
 
   Conferences
Upcoming Conferences
»International Conference and Exhibition on Metabolomics & Systems Biology 20-22 February 2012 San Francisco, USA.
»2nd World Congress on Pharmaceutics & Novel Drug Delivery Systems 20-22 February 2012 San Francisco, USA.
»International Conference and Exhibition on Biometrics & Biostatistics 5-7 March 2012 Omaha, USA.
»2nd World Congress on Clinical & Experimental Dermatology 5-7 March 2012 Omaha, USA
»2nd World Congress on Clinical & Experimental Cardiology 5-7 March 2012 Omaha, USA.
» 2nd World Congress on Clinical & Experimental Ophthalmology 5-7 March 2012 Omaha, USA.
»International Conference & Exhibition on Nanotechnology and Nanomedicine 12-14 March 2012 Omaha, USA.
»World Congress on Gastroenterology and Urology 12-14 March 2012 Omaha, USA
»3rd World Congress on Bioavailability & Bioequivalence: Pharmaceutical R & D Summit 26-28 March 2012 Marriott Hotel, Hyderabad, India.
» International Conference and Exhibition on Neurology &Therapeutics 14-16 May 2012 Renaissance Las Vegas Hotel, Las Vegas, Nevada, USA.
»International Conference and Exhibition on Biosensors & Bioelectronics14-16 May 2012 Las Vegas, USA.
»3rd world Congress on Biomarkers & Clinical Research 2-4 July 2012 Las Vegas, USA.
»2nd world Congress on Proteomics & Bioinformatics 2-4 July 2012 Las Vegas, USA.
»International Conference and Exhibition on Orthopedics 13-15 August 2012 Chicago, USA.
»International Conference and Exhibition on Rheumatology and Therapeutics 14-15 August 2012 Chicago, USA.
»International Conference and Exhibition on Addiction Research & Therapy 20-22 August 2012 Las Vegas, USA.
»2nd World Congress on Virology 20-22 August 2012 Las Vegas, USA.
»International Conference and Exhibition on Nephrology and Therapeutics 20-22 August 2012 Hilton Chicago/Northbrook Chicago, USA.
»2nd World Congress on Vaccines & Vaccination 20-22 August 2012 at Chicago, USA.
»World Congress on Earth Science & Climate Change 21-22 August 2012 Chicago, USA.
»International Conference and Exhibition on pathology 27-29 August 2012 Philadelphia, USA.
»International Conference on Pulmonary & Respiratory Medicine 27-29 August 2012 Philadelphia, USA.
»International Conference and Exhibition on Nutritional Science & Therapy-2012 27-29 August 2012 Philadelphia, USA.
»International Conference on Central Nervous System 5-7 September 2012 Double by Hilton Philadephia, USA.
»International Conference on Occupational Health and Safety Summit 5-7 September 2012 Philadelphia, USA.
»International Conference on Hydrology and Groundwater Expo 10-12 September 2012 Hilton San Antonio Airport, USA.
»2nd World Congress on Cancer Science & Therapy 10-12 September 2012 San Antonio, USA.
»World Congress and Expo on Biowaivers and Biosimilars 10-12 September 2012 San Antonio, TX, USA.
»3rd World Congress on Biotechnology 13-15 September 2012 HICC, Hyderabad, India.
»International Conference on Biodiversity & Sustainable Energy Development 14-15 September 2012 Hyderabad, India.
»World Toxicology Summit & Expo-2012 17-19 September 2012 San Antonio Texas, USA.
»International Conference and Exhibition on Translational medicine-2012, 24-26 September 2012 Chicago USA.
»3rd World Congress on Diabetes & Metabolism which is to be held on 24-26 September 2012 Marriott Convention Center, Hyderabad, India.
»International Conference on Tissue Science and Engineering 1-3 October 2012 San Francisco, USA.
»International conference and Exhibition on Pharmacovigilance and Clinical Trials 1-3 October 2012 San Francisco, USA.
»Omics International Integrative Biology Summit 2012 1-3 October 2012 San Francisco, USA.
»International Conference & Exhibition on Emerging Cell Therapies 1-3 October 2012 San Francisco, USA.
»World Congress on Forensic Research & Technology 15-17 October, 2012 at DoubleTree by Hilton Chicago-North Shore, USA.
»International Conference and Exhibition on Otolaryngology 15-17 October 2012 Chicago, USA.
»International conference on Biothreats and Biodefense 15-17 October, 2012 at DoubleTree by Hilton Chicago-North Shore, USA.
»International Conference on Genetic Syndromes & GeneTherapy 22-24 October 2012 at DoubleTree by Hilton Chicago-North Shore, USA.
»International Conference on Clinical and Cellular Immunology 22-24 October 2012 Las Vegas, USA.
»International Conference and Expo on Material science and Engineering 22-24 October 2012 DoubleTree by Hilton Chicago-North Shore, USA.
» International Expo and Conference on Analytrix & HPLC 22-24 October 2012 Hilton Northbrook, Chicago, USA.
»International Conference and Exhibition on Computer Aided Drug Design & QSAR 29-31 October 2012, Chicago, USA.
»World Congress on Personalised Medicine & Molecular Diagnostics 29-31 october 2012 DoubleTree by Hilton Chicago - Northshore, USA.
»2nd World Congress on Cell Science and Stem Cell Research 12-14 November 2012 Hilton San Antonio Airport, USA.
»International Conference on Clinical Microbiology & Microbial Genomics 12-14 November 2012 San Antonio, USA.
»World Congress on Regenerative and Functional Medicine 12-14 November 2012 at San Antonio, Texas, USA.
»Global Biofuels and Bioproducts Summit 19-21 November 2012 San Antonio, USA.
»International Conference on Genetic Syndromes & GeneTherapy November 19 - 21, 2012 Hilton San Antonio Airport, USA
»International Conference and Exhibition on Probiotics-2012, 19–21 November 2012, Hilton San Antonio Airport, USA.
»International Conference and Exhibition on Food Processing and Technology 22-24 November 2012 Hyderabad, India.
»3rd World Congress on Analytical & Bioanalytical Techniques November 22-24, 2012 Hyderabad International Convention Center, India
»2nd World Congress on Pharmaceutical Regulatory Affairs 23-24 November 2012 HICC Hyderabad, India
»International Conference and Exhibition on Cosmetology & Cosmetics 23-24 November 2012 HICC Hyderabad, India.
»International Conference and Exhibition on Surgery & Transplantation 26-28 November 2012 Hilton San Antonio Airport, USA.
»International conference on Hair Transplantation and Trichology 26-28 November 2012 San Antonio, USA.
»World Congress on Novel approaches in Anaesthesia and Preoperative Care during 26-28 November 2012 San Antonio, USA.
»International Conference on Obesity and Weight Management 3-5 December 2012 Philadelphia, USA.
Previous Conferences Organized/Co-organized
»2nd world Congress on Analytical and Bioanalytical Techniques 16-17 December 2011San franscico, USA.
»2nd World Congress on Diabetes & Metabolism 6-8 December 2011 Philadelphia, USA.
»World Congress on Pediatrics & Gynecology 6-8 December 2011 Philadelphia, USA.
»International Conference and Exhibition on Cell Science & Stem Cell Research 29 Nov-1 Dec 2011 Philadelphia, USA.
»2nd World Congress on Biotechnology 29 Nov -1 Dec 2011 Philadelphia, USA.
»International Conference and Exhibition on Vaccines & Vaccination 22-24 November 2011 Philadelphia, USA.
»2nd World Congress on Biomarkers & Clinical Research 12-14 September 2011 Baltimore, USA.
»International Conference and Exhibition on Virology 5-7 September 2011 Baltimore, USA.
»International Conference and Exhibition on Pharmaceutical Regulatory Affairs 6-7 September 2011 Baltimore, USA.
»International Conference and Exhibition on Cancer Science & Therapy 15-17 August 2011 Las Vegas, USA.
»International Conference on Clinical Research: Dermatology, Ophthalmology and Cardiology 5-6 July 2011 San Francisco, USA.
»International Conference & Exhibition on Proteomics & Bioinformatics 6-8 June 2011 HICC, Hyderabad, India.
»International Conference & Exhibition on Pharmaceutical Biotechnology 6-8 June 2011 HICC, Hyderabad, India.
»2nd World Congress on Bioavailability & Bioequivalence: Pharmaceutical R & D Summit 6-8 June 2011 Las Vegas, USA.
»International Conference on Pharmaceutics & Novel Drug Delivery Systems 7-8 June Las Vegas, USA.
»World Congress on Biotechnology 21-23 March 2011 Hyderabad, India.
»International Conference on Diabetes and Metabolism 13-14 December 2010 Santa Clara, USA.
»International Conference on Biomarkers & Clinical Research 22-23 November 2010 Santa Clara, USA
»International Conference and Exhibition on Analytical and Bioanalytical Techniques: Pharmaceutical R & D Summit 01 - 03 November 2010 Hyderabad, India
»International Conference & Exhibition on Bioequivalence & Bioavailability 2010, Pharmaceutical R & D Summit March 01-03, 2010.
»Integrating Glycomics with other Omics in Cancer Detection and Diagnosis, January 19-20, 2010, Stanford University School of Medicine.
»3rd World Congress of Gene-2009, December 1-7, 2009.
»7th Annual World Congress of International Drug Discovery Science & Technology, October 22-25.
»2nd WSA-2009, July 18-20, 2009
»1st CCSB-2009, February 16-17, 2009
»2nd PRICPS-4th AOHUPO, June 22-26, 2008
»95th ISCA, January 5-8, 2008

Search :     Advanced Search 

Home   |   Join   |   Contact     

    
Journal Details
 
 
Research Article Open Access
Induction of Differential Growth in vitro by High-risk Human Papillomavirus in Human Breast Cancer Cell Lines is Associated with Caspase Dysregulation
1Department of Biomedical Sciences, School of Dental Medicine, University of Nevada, Las Vegas
2Department of Clinical Sciences, School of Dental Medicine, University of Nevada, Las Vegas
3Department of Biological Sciences, University of Nevada, Las Vegas
§These authors contributed equally to this work
*Corresponding author: Dr. Karl Kingsley
Department of Biomedical Sciences
School of Dental Medicine
University of Nevada, Las Vegas
E-mail : karl.kingsley@unlv.edu
 
Received October 28, 2009; Accepted November 30, 2009; Published November 30, 2009
 
Citation: Kingsley K, Zuckerman J, Davis M, Matteucci M, Knavel A, et al. (2009) Induction of Differential Growth in vitro by High-risk Human Papillomavirus in Human Breast Cancer Cell Lines is Associated with Caspase Dysregulation. J Cancer Sci Ther 1: 062-071. doi:10.4172/1948-5956.1000010
 
Copyright: © 2009 Kingsley K, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
 
Abstract
 
Introduction
 
Many viruses have been associated with human breast cancers, including Epstein-Barr and Cytomegalovirus. New evidence has revealed the frequent presence of highrisk human papillomavirus (HPV) strains HPV16 and HPV18 in breast carcinoma biopsies. These findings raise the question of whether HPV may infect developing cancers and mediate their growth and development, as was recently observed with oral cancers. The goal of this study is to test the hypothesis that these high-risk HPV strains are sufficient to significantly alter phenotypes of already transformed human breast cancer cell lines.
 
Materials and methods
 
A series of in vitro experiments, including proliferation, adhesion and viability assays, were used to quantify the effects of HPV16 and HPV18 on the human breast cancer cell lines, T-47D and MCF7, following transient transfection with the full length HPV virus. Normal breast and fibroblast cell lines, MCF10A and Hs27, were used as noncancerous controls.
 
Results
 
HPV16 and HPV18 significantly inhibited proliferation and adhesion of T-47D cells, although viability was not affected. Differential effects on proliferation were observed in MCF7 cells; HPV16 inhibited proliferation, while HPV18 stimulated proliferation. No measurable effects in adhesion or viability in MCF7 cells were observed. The phenotypic changes in T-47D and MCF7 cells were associated with changes in mRNA expression of caspase-2,-3 and -8, but not p53 or GAPDH. No measurable changes in proliferation or viability were observed following HPV transfection in the normal human breast cell line, MCF10A, or the normal human fibroblast cell line, Hs27, although adhesion was differentially affected.
 
Conclusions
 
Although HPV is a primary cause of virtually all cervical cancers, it is found as a concomitant infection in many other tumors. While HPV may initiate carcinogenesis in these tumors, recent studies suggest HPV may also modulate the progression or malignancy process in already transformed cancers. Determining what effects HPV has on already transformed breast cancers may therefore become an important step towards understanding the factors that will lead to more effective treatment options for a significant proportion of breast cancer patients.
 
Keywords
 
Breast cancer; Human papillomavirus
 
Introduction
 
Viruses, including Epstein-Barr, Cytomegalovirus, and Herpes simplex virus, have been implicated in the etiology of human breast cancers (Lawson et al., 2001; Lawson et al., 2006; Tsai et al., 2007). Recent evidence now suggests that high-risk human papillomavirus (HPV) strains HPV16 and HPV18, primarily associated with cervical cancers, are also present in as many as half of breast carcinoma biopsies (Kan et al., 2005; de Villiers et al., 2005). HPV has been implicated as the causative agent in many intraepithelial neoplasias and invasive squamous cell carcinomas, with the HPV16 and HPV18 strains most frequently observed, with HPV16 the most prevalent among noncervical cancers, such as oral and breast cancers (Herrero et al., 2003; Munoz et al., 2003; Kan et al., 2005; Smith et al., 2007).
 
Infection with high-risk HPV plays a central role in the carcinogenesis and etiology of nearly all cases of cervical cancer, therefore HPV may also function to transform oral and breast tissue (Walboomers et al., 1999; Kreimer et al., 2005; Syrjanen 2005). However, evidence from oral biopsies reveals a comparatively low presence of HPV in pre-malignant oral lesions (10%), suggesting a role other than transformation (Kreimer et al., 2005; Syrjanen, 2005). More recent evidence demonstrates that high-risk HPV strains most commonly associated with these HPV-positive oral cancers significantly alters in vitro growth (Kingsley et al., 2006; Reddout et al., 2007). When combined with evidence that HPV is present only in a subset of oral cancers, these data imply that HPV infection may contribute to the malignancy process in existing or developing cancers, rather than acting as a primary factor for inducing carcinogenesis (Gillison et al., 2000; van Houten et al., 2001).
 
The recent detection of HPV in a subset of breast cancers raises the question of whether, in addition to a role in carcinogenesis, HPV may also preferentially infect already developing tumors and subsequently mediate their growth (Kan et al., 2005; de Villiers et al., 2005). New evidence to determine the specific role of HPV in breast carcinogenesis suggests HPV may be involved in the transformation process in a majority of the cases examined (Khan et al., 2008). However, these data further suggest that in a significant subset of cases, other factors were likely responsible for initiation of carcinogenesis and that HPV may have preferentially infected these tumors, but not the surrounding tissue. Based upon this information, this study was designed to understand what effects HPV may have on already existing breast cancer cells.
 
Researchers hypothesize that several of the same risk factors for developing cancer may also enhance the risk for acquiring HPV infection. The main risk factors associated with breast cancer include family history of disease, levels of hormones such as estrogen and progesterone, as well as cigarette smoking and alcohol consumption (Dean, 2008; Mahoney et al., 2008). These risk factors are not exclusive to breast cancer risk and may also be strongly linked with HPV infection.
 
Interestingly, one recent study found that two HPV genes, E6 and E7, were sufficient to induce changes to metastatic phenotypes in MCF7 and BT20 breast cancer cells, in vitro and in vivo (Yasmeen et al., 2007a; Yasmeen et al., 2007b). To date, no studies have yet examined the effects of the full-length HPV16 or HPV18 virus on the proliferative phenotype of established breast cancers. This study is among the first to provide direct evidence that elucidates the ability of HPV infection to alter the proliferative phenotype of breast cancers in vitro.
 
Materials and Methods
 
Cell culture
 
The human breast cancer cell lines used in this study, MCF7 (HTB-22) and T-47D (HTB-133), as well as the non-tumorigenic epithelial breast cell line MCF10A (CRL-10317) and normal human fibroblast cell line Hs27 (CRL-1634), were obtained from American Type Culture Collection (ATCC: Manassas, VA). In addition, CaSki (CRL-1550: epidermoid carcinoma, cervix) and GH354 (CRL-13003: human cervical adenocarcinoma) were also obtained from ATCC as HPV16 and HPV18 positive controls, respectively. Hs27 fibroblast control and GH354 cervical adenocarcinoma cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) with 4 mM L-Glutamine, adjusted to contain 3.7 g/L sodium bicarbonate and 4.5 g/L glucose, from Hyclone (Logan, UT). T-47D and CaSki cells were maintained in RPMI-1640 medium with 2mM L-Glutamine, adjusted to contain 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES, and 1.0 mM sodium pyruvate. MCF7 cells were maintained in Minimum Essential Medium (MEM) with 2.00 mM L-Glutamine with Earle’s Balanced Salts. MCF10A breast control cells were maintained in DME/F-12 with 2.50 mM LGlutamine and 15 mM HEPES buffer with 0.5 mg/ml hydrocortisone, 10 μg/mL EGF, 5 mg/ml insulin and 100 ng/ml cholera toxin. Media for all cell lines were supplemented with 10% fetal bovine serum (FBS), and with 1% Penicillin (10,000 units/ mL)-Streptomycin (10,000 μg/ml) solution (HyClone), except GH354 which was supplemented with 20% FBS and 1% Penicillin- Streptomycin. Cell cultures were maintained in 75 cm2 BD Falcon tissue-culture treated flasks (Bedford, MA) at 37°C and 5% CO2 in humidified chambers.
 
HPV screening
 
To determine if these cell lines already harbor HPV, DNA was isolated from 1.5 x 107 cells from each cell line using the GenomicPrep DNA isolation kit (Amersham Biosciences: Buckinghamshire, UK), using the procedure recommended by the manufacturer. To confirm the absence of HPV DNA in each cell line prior to transfection and presence of HPV DNA in each cell line post-transfection, PCR was performed with the Fisher exACTGene complete PCR kit (Fisher Scientific: Fair Lawn, NJ) and a Mastercycler gradient thermocycler (Eppendorf: Hamburg, Germany) using the following primers synthesized by SeqWright (Houston, TX):
 
HPV18 forward primer, ATGGCGCGCTTTGAGGATCC;
HPV18 reverse primer, GCATGCGGTATACTGTCTCT;
HPV16 forward primer, ATGTTTCAGGACCCACAGGA;
HPV16 reverse primer, CCTCACGTCGCAGTAACTGT.
 
One μg of template DNA was used for each reaction. The initial denaturation step ran for 1 minute at 94°C. Thirty amplification cycles were run, consisting of 30 second denaturation at 94°C, 60 seconds of annealing at 58°C, and 6.5 minutes of extension at 68°C. Final extension was run for 5 minutes at 68°C. Reaction products were separated by gel electrophoresis using Reliant 4% NuSieve® 3:1 Plus Agarose gels (Lonza: Rockland, ME). Bands were visualized by UV illumination of ethidium-bromide-stained gels and captured using a Kodak Gel Logic 100 Imaging System and 1D Image Analysis Software (Eastman Kodak: Rochester, NY).
 
Transfection
 
MCF7 (HTB-22), T-47D (HTB-133), MCF10A (CRL-10317) and Hs27 (CRL-1634) cells were transfected with HPV16 and HPV18. Briefly, cells were seeded in 25cm2 BD Falcon tissueculture treated flasks in appropriate media (as described) and allowed to achieve 70% confluence. Cells were then transiently transfected by adding 1 μg/ml of full-length HPV type 16, cloned into the pBluescript SK-vector (ATCC #45113) or HPV type
18, cloned into the pBR322 vector (ATCC #45152). The transfections were performed using the Stratagene Mammalian Transfection Kit (La Jolla, CA) according to the manufacturer’s recommended protocol for CaPO4 transfection. Mock transfectants (mTF) of these four cell lines were also established by performing the same transfection protocol, but without using virus (empty vector).
 
To test the effectiveness of the transient transfections, RNA was isolated from 1.5 x 107 cells of each of the experimental and control cell lines, using ABgene Total RNA Isolation Reagent (Epsom, Surrey, UK) and the procedure recommended by the manufacturer. To quantify the expression of HPV mRNA, RT-PCR was performed on total RNA using the ABgene Reverse-iT One-Step RT-PCR Kit (ReadyMix Version) and a Mastercycler gradient thermocycler (Eppendorf: Hamburg, Germany) using the HPV18 and HPV16 primers synthesized by SeqWright (Houston, TX).
 
One μg of template (total) RNA was used for each reaction. The reverse transcription step ran for 30 minutes at 47°C, followed by denaturation for 2 minutes at 94°C. Thirty-five amplification cycles were run, consisting of 20 second denaturation at 94°C, 30 seconds of annealing at 58°C, and 6.5 minutes of extension at 72°C. Final extension was run for 5 minutes at 72°C. Reaction products were separated by gel electrophoresis using Reliant 4% NuSieve® 3:1 Plus Agarose gels (Lonza: Rockland, ME). Bands were visualized by UV illumination of ethidiumbromide- stained gels and captured using a Kodak Gel Logic 100 Imaging System and 1D Image Analysis Software (Eastman Kodak: Rochester, NY). Quantitation of RT-PCR band densitometry and relative mRNA expression levels was performed using Adobe Photoshop (San Jose, CA) imaging software, Image Analysis tools.
 
Proliferation
 
Proliferation assays were performed with MCF7, T-47D, MCF10A, and Hs27 cells with the appropriate complete media in Corning Costar 96-well assay plates (Corning, NY), using HPV16 or HPV18 transfected cells, mock-transfected cells, and non-transfected controls. Cells were seeded at a concentration of 1.2 x 104 cells per well and proliferation was measured over three days at four time points (day 0 - day 3), as previously described (Kingsley et al., 2006; Reddout et al., 2007). Cultured cells were fixed at each time point, 0 hours (day 0), 24 hours (day 1), 48 hours (day 2), and 72 hours (day 3), using 50μl of 10% buffered formalin and subsequently stained with crystal violet 1% aqueous solution (Fisher Scientific: Fair Lawn, NJ). Relative absorbance was then measured at 630 nm using a Bio-Tek ELx808 microplate reader (Winooski, VT) and data were analyzed and graphed using Microsoft Excel (Redmond, WA) and SPSS (Chicago, IL). Three separate, independent replications of each experiment were performed.
 
Adhesion
 
Adhesion assays were performed at a concentration of 1.2 x 105 cells per well (100 μl of 1.2 x 106 cells/ml solution suspended in serum-free DMEM, MEM, DME:F-12 or RPMI with no additives) in uncoated Corning Costar 96-well assay plates (Corning, NY) as previously described (Plopper et al., 1995; Wagner et al., 2002; Reddout et al., 2007). Cells were allowed to attach for 30 minutes at 37°C with one modification to the standard adhesion assay. The modified adhesion assays used in this study eliminated the plate suspension step, in which nonadherent cells are generally removed by suspending the plate upside-down in a rotating tank of PBS, which greatly enhances the sensitivity of this assay, as previously described (Kingsley et al., 2006). Following the incubation period, the cells were fixed using 50 μl of 10% buffered formalin and subsequently stained with crystal violet 1% aqueous solution (Fisher Scientific: Fair Lawn, NJ). Relative absorbance was then measured at 630 nm using a Bio-Tek ELx808 microplate reader (Winooski, VT) and data were analyzed and graphed using Microsoft Excel (Redmond, WA). Three separate, independent replications of each assay were performed.
 
Viability
 
Prior to plating cells for adhesion and proliferation assays, aliquots of trypsinized cells were stained using Trypan Blue (Sigma: St. Louis, MO), and live cells were enumerated by counting the number of Trypan-blue negative cells using a VWR Scientific Counting Chamber (Plainfield, NJ) and a Zeiss Axiovert 40 inverted microscope (Gottingen, Germany). At each time point (day 0-3), several wells were processed using the Trypan stain, and live cells were enumerated using this procedure (Felsher et al., 2000; Kingsley et al., 2002).
 
RT-PCR
 
RNA was isolated from 1.5 x 107 cells of each of the experimental and control cell lines, using ABgene Total RNA Isolation Reagent (Epsom, Surrey, UK) and the procedure recommended by the manufacturer three days after transfection. RTPCR was performed on total RNA using the ABgene ReverseiT One-Step RT-PCR Ki t (ReadyMix Version) and a Mastercycler gradient thermocycler (Eppendorf: Hamburg, Germany), as described above. The following primers for p53 (Vakifahmetoglu et al., 2006), caspase-2 and caspase-3 (Kugu et al., 1998), caspase-8 (Ruiz-Ruiz et al., 2004), and glyceraldehyde- 3- phosphate dehydrogenase (GAPDH) (Wolter et al., 2003), synthesized by SeqWright (Houston, TX), were used:
 
p53 forward primer, ACCAGGGCAGCTACGGTTTC;
p53 reverse primer, CCTGGGCATCCTTGAGTTCC;
caspase-2 forward primer,
TGGCATATAGGTTGCAGTCTCGG;
caspase-2 reverse primer,
TGTTCTGTAGGCTTGGGCAGTTG;
caspase-3 forward primer,
ACATGGAAGCGAATCAATGGACTC;
caspase-3 reverse primer,
AAGGACTCAAATTCTGTTGCCACC;
caspase-8 forward primer, GATATTGGGGAACAACTGGAC;
caspase-8 reverse primer, CATGTCATCATCCAGTTTGCA;
GAPDH forward primer, ATCTTCCAGGAGCGAGATCC;
GAPDH reverse primer, ACCACTGACACGTTGGCAGT;
 
Bands were visualized by UV illumination of ethidium-bromide- stained gels and captured using a Kodak Gel Logic 100 Imaging System and 1D Image Analysis Software (Eastman Kodak: Rochester, NY). Quantitation of RT-PCR band densitometry was performed using Adobe Photoshop (San Jose, CA) imaging software, Image Analysis tools.
 
Statistics
 
The differences between treatments were measured using a t distribution (α=0.05). All samples were analyzed using twotailed t-tests, as departure from normality can make more of a difference in a one-tailed than in a two-tailed t-test. As long as the sample size is even moderate (>20 for each group), quite severe departures from normality make little practical difference in the conclusions reached from these analyses (Hays, 1994). However, analyses involving multiple two sample t-tests have a higher probability of Type I error, leading to false rejection of the null hypothesis, H0 (Hays, 1994). To confirm the effects observed from these experiments and minimize the possibility of Type I error, further analysis of the data was facilitated with ANOVA using SPSS (Chicago, IL) to more accurately assess relationships and statistical significance among and between groups.
 
Results
 
HPV screening
 
To confirm that each cell line did not already harbor HPV, DNA was isolated from cultured cells and PCR performed using primers specific for HPV16 and HPV18. In addition, two HPV-positive cervical cancer cell lines, CaSki (HPV16) and GH354 (HPV18), were included as positive controls (Figure 1). These results demonstrated that T-47D, MCF7, MCF10A, and Hs27 were not found to contain endogenous HPV, while confirming that CaSki and GH354 harbor HPV16 and HPV18, respectively. Furthermore, the presence of HPV DNA was not observed in mock transfectants, but could be verified post-transfection.
 
Transfection
 
Effectiveness of the transient transfections and expression of HPV mRNA was assessed by performing RT-PCR on total RNA isolated from each cell line post-transfection and on the cell lines known to harbor endogenous HPV (CaSki, GH354). These results demonstrate that each HPV16-transfectants (Hs27- HPV16 and MCF10A-HPV16), expressed roughly equivalent amounts of virus mRNA, while MCF7-HPV16 andT-47DHPV16 had slightly higher HPV mRNA expression profiles (Figure 2). Comparison with CaSki HPV16-specific mRNA reveals that endogenous HPV expression was approximately equivalent to the transfectants, although slightly lower among the normal cell lines. HPV18-transfectants (Hs27-HPV18, MCF10A-HPV18, MCF7-HPV18, and T-47D-HPV18) expressed roughly equivalent amounts of virus mRNA, while comparison with GH354 HPV18-specific mRNA revealed that endogenous HPV mRNA expression was slightly higher than that of HPV18 transfectants.
 
f
Figure 1: HPV was detectable in experimental cell lines only after transfection.
(A) PCR from total DNA demonstrated that CaSki and GH354 contain HPV16 and HPV18 specific sequences, respectively. PCR from total DNA of experimental cell lines confirms T-47D (A), MCF7, MCF10A and Hs27 (B) do not harbor these HPV-specific sequences. Following transfection with the fulllength HPV genome, each cell was found to contain HPV16 or HPV18 sequences, but not among mock transfectants (empty vector), such as T-47D mTF (A) or MCF7 mTF (B).
 
fig
Figure 2: HPV expression in vitro was comparable among transfectants. RT-PCR confirmed HPV expression in all four cell lines (T-47D, MCF7, MCF10A and Hs27) following HPV16 or HPV18 transfection. Scanning densitometry measurement of relative endpoint RT-PCR band intensities from all HPV18-transfectants were comparable, although lower than endogenous HPV expression from GH354 cells (top). HPV mRNA expression in T-47D and MCF7 HPV16-transfectants were roughly equivalent to endogenous expression from CaSki cells, and slightly higher than expression in normal cells, Hs27 and MCF10A (bottom).
 
Previous studies with oral cancers revealed that transfection with the full-length HPV16 and HPV18 genome significantly altered cellular proliferation, adhesion, and viability. To test the hypothesis that HPV16 and HPV18 strains similarly alter the phenotypes of breast cancer cells, in vitro assays were performed following transfection with HPV16 and HPV18.omains, we should gain invaluable, clinically significant insights for optimal therapeutic interventions.
 
HPV inhibited proliferation and adhesion in T-47D cells
 
Transfection of T-47D cells with HPV16 resulted in lower proliferation compared with non-transfected controls (-42%), as did HPV18 (-39%) (p<0.01, n=216) (Figure 3A). Because these analyses involved multiple two-sample t-tests and a higher probability of Type I error, ANOVA was performed. This analysis confirmed that both HPV16 and HPV18 inhibited cellular proliferation in T-47D cells. T-47D-HPV16 proliferation was not significantly different from T-47D-HPV18 proliferation, however, they were both significantly different from the mock and non-transfected controls.
 
f
Figure 3: Proliferation and adhesion of T-47D cells was significantly inhibited by HPV16 or HPV18 in vitro. HPV-transfected and control T-47D cells were plated in 96-well assay plates with media containing 10% FBS and were allowed to proliferate for three days. (A) HPV16 and HPV18 transfected cells exhibited reduced proliferation significantly (-42%, -39%, respectively; p<0.01, n=216). (B) T-47D adhesion was significantly inhibited by HPV16 (-15.9%) and HPV18 (-15.1%), as measured by modified 30-minute adhesion assays (p<0.05, n=72).
 
HPV induced differential changes in MCF7 cell proliferation
 
Transfection of the MCF7 cells with HPV16 reduced proliferation (-9.9%), while HPV18 stimulated proliferation (+10.4%) in comparison to non-transfected controls (p<0.05, n=216) (Figure 4A). Two-tailed t-tests and one-way ANOVA confirmed this differential response was statistically significant between both experimental groups and the controls.
 
f
Figure 4: Proliferation of MCF7 cells, but not adhesion, was differentially influenced by HPV16 or HPV18 in vitro.
HPV-transfected and control MCF7 cells were plated in 96-well assay plates with media containing 10% FBS and were allowed to proliferate for three days. (A) HPV16-transfected cell proliferation was ignificantly inhibited (-9.9%), while HPV18-transfected cell proliferation was significantly enhanced (+10.4%) (p<0.05, n=216). (B) MCF7 cell adhesion was not significantly affected by HPV16 (-0.6%) or HPV18 (+6.8%), as measured by modified 30-minute adhesion assays (p>0.05, n=72).
 
In contrast to the differential response in proliferation observed following HPV transfection, no significant changes to adhesion were observed in MCF7 cells (Figure 4B). Analysis of cellular viability revealed only minor, non-significant reductions in cellular viability between the HPV-transfected MCF7 cells and controls (Table 1).
 
HPV induced minor changes to adhesion in the normal breast cell line, MCF10A
 
To contextualize the HPV-induced changes in the setting of breast cancer phenotypes that were observed, the responses of a non-cancerous cell line were also assayed using the normal human breast cell line, MCF10A. These experiments found no significant differences between transfected (HPV16 or HPV18) and non-transfected cells (Figure 5A). Two-tailed t-tests and ANOVA were used to confirm that no statistical significance was evident between these groups.
 
Although HPV exhibited no significant effects on the growth or proliferation of MCF10A cells, cellular adhesion and viability assays were also performed to assess if other behaviors were affected. Unlike growth and proliferation, cellular adhesion of MCF10A cells was significantly altered by HPV16 (+9.5%, p<0.01, n=144) and HPV18 (+11.06%, p<0.01, n=144) compared with non-transfected controls (Figure 5B), although no differences in viability were observed (Table 1).
 
Table 1: Cell viability in control and HPV-transfected cells.
   
 
HPV induced minor changes to adhesion in the normal fibroblast cell line, Hs27
 
To further compare and contrast the HPV-induced phenotypic that were observed between the cancerous and non-cancerous cells tested, the responses of another non-cancerous cell line were also assayed using the normal human fibroblast cell line, Hs27. The results revealed no significant differences between the proliferation of Hs27 cells transfected with HPV16 or HPV18 and non-transfected Hs27 controls (p>0.05, n=72) (Figure 6A). Two-tailed t-tests confirmed no statistical differences in proliferation were found between the groups (Hs27-HPV16, p>.05; Hs27-HPV18, p>.05). ANOVA confirmed there were no significant differences between or within the experimental and control groups.
 
In addition to testing the effects of HPV16 and HPV18 on the proliferation of Hs27 cells, cellular adhesion and viability were assessed. Adhesion of the non-transfected Hs27 cells was significantly inhibited by HPV16 (-19.25%, p>0.05, n=72) but not by HPV18 (+13.12%, p>0.05, n=72) (Figure 6B). In addition, no significant changes in viability were observed with Hs27- HPV16 or HS27-HPV18 transfectants (Table 1).
 
RT-PCR
 
Researchers have established that the principle tumorigenic activity of HPV early genes, including E6, may be the targeting, subsequent degradation, and down regulation of the tumor suppressor p53 (Scheffner et al., 1990; Sun et al., 2008). Because damaged genes and other molecular pathways in cancerous cells may involve deactivation of key tumor suppressors, such as p53, total RNA was extracted from cells and relative endpoint (RE) RT-PCR was performed to assess p53 expression in these cells (Figure 7). Wild type p53 expression was observed in both T-47D (Figure 7A) and MCF7 (Figure 7B) breast cancer cell lines, confirming earlier observations (Ho et al., 2005; Parssinen et al., 2008). The expression levels of p53 mRNA, however, were not significantly altered by HPV16 or HPV18 transfection in either cell line over the time course of these assays (Day 3 shown; Figure 7A, B), as was recently demonstrated in some oral cancer cell lines transfected with HPV (Chatelain et al., 2008).
 
fig
Figure 5: HPV16 and HPV18 did not significantly alter MCF10A phenotypes in vitro. HPV-transfected and control MCF10A cells were plated in 96-well assay plates with media containing 10% FBS and were allowed to proliferate for three days. (A) HPV16- and HPV18-transfected cell proliferation was similar and not significantly different from control cells (p>0.05, n=216). (B) MCF10A cell adhesion was significantly enhanced by HPV16 (+9.5%) and HPV18 (+11.06%), as measured by modified 30-minute adhesion assays (p<0.05, n=72).
 
Recently, other studies have suggested that HPV viral genome amplification may also be dependent upon caspase-mediated cleavage within the infected cells, which in turn may influence differentiation and cellular replication rates (Moody et al., 2007; Coelho et al., 2008). (RE) RT-PCR was performed to determine if the effects of HPV16 and HPV18 transfection on these cells correlated with differential expression of specific members of the caspase family (Figure 7). In sharp contrast to p53 expression, marked increases in the expression of caspase-2, - 3, and-8 mRNA were observed in T-47D cells following HPV transfection (Figure 7A). MCF7 cells, however, exhibited differential responses to HPV transfection (Figure 7B), with HPV16 reducing and HPV18 stimulating caspase-2 mRNA expression levels. Interestingly, caspase-3 mRNA expression was undetectable in this cell line and no significant changes in caspase-8 mRNA were observed in either cell line. No changes to mRNA expression levels were observed in Hs27 or MCF10A cells (data not shown).
 
fig
Figure 6: HPV16 and HPV18 did not significantly alter Hs27 phenotypes in vitro.
HPV-transfected and control Hs27 cells were plated in 96-well assay plates with media containing 10% FBS and were allowed to proliferate for three days.
(A) HPV16- and HPV18-transfected cell proliferation was similar and not significantly different from control cells (p>0.05, n=216). (B) Hs27 cell adhesion was significantly inhibited by HPV16 (-19.25%), but not by HPV18 (-13.12%), as measured by modified 30-minute adhesion assays (p>0.05, n=72).
 
To quantify the relative changes in mRNA expression levels from the experimental and control groups, scanning densitometry was performed. Specifically, HPV16 increased expression of the apoptosis initiators caspase-2 (+28.55%) and caspase-3 (+47.55%), as well as the apoptosis-effector caspase-8 (+32.02%) in T-47D cells; HPV18 also increased expression of caspase-2 (+26.37%), caspase-3 (+53.87%) and caspase-8 (+50.63%), revealing that caspase mRNA expression levels were significantly altered by HPV16 or HPV18, but not levels of p53 or GAPDH mRNA. The differential response of MCF7 cells, however, revealed that HPV16 reduced expression of caspase- 2 (-14.5%), while HPV18 increased caspase-2 mRNA expression (+18.34%).
 
Discussion
 
Persistent infection with high-risk, oncogenic HPV strains has been firmly established as the primary cause of virtually all cases of cervical cancer (Walboomers et al., 1999; Castellsague, 2008). In contrast, ample evidence now confirms that HPV is present in a subset of oral cancers and more recently, in breast cancers that may be unrelated to carcinogenesis (Kan et al., 2005; de Villiers et al., 2005; Kreimer et al., 2005; Syrjanen, 2005). Some evidence now suggests that HPV infection in these tissues may contribute to, rather than directly cause, the malignancy or transformation process.
 
For example, a recent study explored the potential roles of HPV in breast cancer patients. This study revealed that approximately two-thirds of normal epithelial tissue samples taken from sites adjacent to HPV16-expressing breast carcinomas also contained HPV16 DNA (Khan et al., 2008), suggesting that HPV may have induced transformation in the larger subset of these breast cancer patients. However, these data also provide strong evidence that HPV was not involved in the etiology of the smaller subset, which did not contain any discernable evidence of a localized HPV infection. Although many studies suggest that specific oncogenic HPV strains may be present in up to half of breast cancer biopsies, few studies to date have investigated the possibility that HPV infection may, in fact, mediate specific phenotypes associated with the malignancy process (Kan et al., 2005; de Villiers et al., 2005). This study is among the first to provide direct evidence that HPV is capable of modulating the proliferative phenotypes of existing breast cancers.
 
fig
Figure 7: T-47D and MCF7 mRNA analysis.
RT-PCR was performed on total RNA extracted from 107 T-47D (A) and MCF7 (B) cells at 24 and 48 hours (data not shown), and 72 hours. Relative endpoint (RE) RT-PCR revealed that p53 and GAPDH expression levels remained relatively constant pre- and post-transfection in both cell lines. HPV16 and HPV18 significantly enhanced expression of caspase-2, -3 and -8 in T-47D cells (A), while no significant changes were noted in MCF7 cells (B). Note: caspase-3 mRNA was undetectable in MCF7 cells at all time points. Scanning densitometry was performed from RE-RT-PCR results, revealing HPV16 increased expression of caspase-2 (+28.55%), caspase-3 (+47.55%), and caspase-8 (+32.02%) in T-47D cells; MCF7 cells exhibited a differential response, with HPV16 reducing expression of caspase-2 (-14.5%) and HPV18 increasing caspase-2 mRNA expression (+18.34%); no significant measurable differences in caspase-8 mRNA were evident.
 
Based upon results from other studies demonstrating HPV mediates the proliferative phenotypes of oral cancers (Kingsley et al., 2006; Reddout et al., 2007), the current study investigated whether high-risk HPV16 and HPV18 strains induce significant and measurable changes in breast cancer phenotypes, including proliferation. The results indicated that either HPV strain is sufficient to alter growth rates in both of the breast cancer cell lines examined, but not normal cells. Although previous evidence has demonstrated that HPV16 and HPV18 were sufficient to immortalize a normal human mammary epithelial cell line, these studies were not designed to explore the possibility that HPV might have differential effects in already transformed
cells (Band et al., 1990). Moreover, previous studies of HPV-mediated effects on normal cell lines, including human foreskin keratinocytes and normal breast tissues, were designed to assay HPV-induced immortalization, or escape from senescence, rather than the relative proliferation or turnover rates of these cells in culture (Band et al., 1990; Hawley-Nelson et al., 1999). Finally, new evidence is emerging which suggests HPV infection in some oral cancers may actually increase patient survival under certain conditions, suggesting a clinical correlation with these differential proliferative responses (Fischer et al., 2009; Jung et al., 2009).
 
The experimental design of this study was employed specifically to reveal the presence of differential responses, not only between the cell lines, but also between different HPV strains within the same cell line. These data now suggest complex inter- relationships between the effects of HPV infection and intrinsic cellular or cytogenetic differences. Moreover, these results bear some resemblance to previous work from this laboratory that demonstrated these high risk HPV strains do not elicit equivalent responses among all oral cancer cell lines tested, and that different HPV strains may inhibit or increase cell proliferation within the same cell line (Reddout et al., 2007).
 
HPV elicits cellular responses as part of the transformation process in cervical epithelia, yet those specific responses were not observed in the breast cancer cell lines in this study. For instance, HPV viral replication proteins influence cellular proliferation in most cervical cancers by inactivating degrading, and subsequently down regulating tumor suppressor proteins, such as p53 (Scheffner et al., 1990; Werness et al., 1990). However, in this study, HPV transfection did not significantly alter p53 expression in either breast cancer cell line, which may seem at odds with the evidence from cervical cancers.
 
Recent work now confirms that many viruses have evolved alternative mechanisms to inhibit p53 function. For example, p53 deactivation may occur via site-specific serine phosphorylation in some cells without mRNA down regulation (Shin et al., 2006; Sun et al., 2008). Data indicating that wild-type p53 expression was not reduced by HPV transfection in these breast cancers might suggest that HPV in these cell lines may instead utilize other mechanisms, such as phosphorylation-mediated inactivation of p53. Future studies are now planned to explore these potential mechanisms.
 
Although deregulation or deactivation of p53 and other tumor suppressors may be critical to the mechanisms of the HPV life cycle, other work has demonstrated that HPV viral genome amplification may also be dependent upon caspase-mediated functions within infected cells (Moody et al., 2007; Coelho et al., 2008). These studies reveal that the productive viral life cycle of HPV is significantly enhanced by caspase-mediated cleavage that may, in fact, be integral to the HPV viral life cycle. Aside from their incidental involvement in the HPV life cycle, caspases function primarily as potent activators of cellular apoptosis and are known to inhibit cellular proliferation. Caspase up-regulation and proliferation inhibition have also been observed in previous work using cervical cancer cells (Moody et al., 2007; Coelho et al., 2008; Singh and Singh, 2008). Intriguingly, the anti-cancer mechanism of Taxol (Paclitaxel), a potent treatment for ovarian, lung and breast cancers, was recently determined to involve activation of members of the caspase family, more specifically caspase-8 (Lee et al., 2005).
 
Despite the growing evidence that high-risk HPV strains are present in many breast tumors, few studies have examined the ability of HPV to modulate cellular phenotypes in these cancers. Although epidemiologic studies suggest other risk factors, such as genetic predisposition and tobacco or alcohol use, are likely responsible for breast oncogenesis, new evidence suggests concomitant HPV infection may significantly alter tumor growth. This study provides direct evidence that HPV16 and HPV18 can modulate the proliferative phenotypes in existing breast cancer cell lines, although more research is needed to understand the complex inter-relationships between the observed effects of HPV infection and specific intrinsic or cytogenetic differences that control this phenomenon. Determining the effects of HPV on already transformed breast cancers is thus an important step towards understanding the factors that will ultimately lead to more accurate prognosis and more effective treatment options for breast cancer patients with concomitant HPV infections.
 
Acknowledgements
 
This research was supported by a Research Development Award (RDA) to KK from the UNLV Office of Research Services. KK would like to thank Laurel Pritchard, Kenneth Fernandez and Chandler Marrs for their invaluable assistance with the editing of this manuscript.
 
References
 
  1. Band V, Zajchowski D, Kulesa V, Sager R (1990) Human papilloma virus DNAs immortalize normal human mammary epithelial cells and reduce their growth factor requirements. Proc Natl Acad Sci USA 87: 463-467. »  CrossRef  »  PubMed  »  Google Scholar

  2. Castellsague X (2008) Natural history and epidemiology of HPV infection and cervical cancer. Gynecol Oncol 110: S4-7.»  CrossRef  »  PubMed  »  Google Scholar

  3. Chatelain K, Phippen S, McCabe J, Teeters CA, O’Malley S, et al. (2008) Cranberry and grape seed extracts inhibit the proliferative phenotype of oral squamous cell carcinomas. Evid Based Complement Alternat Med [Epub ahead of print]. »  CrossRef  »  PubMed  »  Google Scholar

  4. Coelho RA, Focchi GR, Nogueira-de-Souza NC, Sartori MG, Silva ID, et al. (2008) Prognostic markers of low-grade squamous intraepithelial lesions: the role of topoisomerase II alpha and active caspase-3. Eur J Gynaecol Oncol 29: 499-501. »  PubMed  »  Google Scholar

  5. Dean A (2008) Primary breast cancer: risk factors, diagnosis and management. Nurs Stand 22: 47-55. »  PubMed  »  Google Scholar

  6. de Villiers EM, Sandstrom RE, Hausen ZH, Buck CE (2005) Presence of papillomavirus sequences in condylomatous lesions of the mammillae and in invasive carcinoma of the breast. Breast Cancer Res 7: R1-R11.»  CrossRef  »  PubMed  »  Google Scholar

  7. Felsher DW, Zetterberg A, Zhu J, Tisty T, Bishop JM (2000) Overexpression of MYC causes p53-dependent G2 arrest of normal fibroblasts. Proc Natl Acad Sci USA 97: 10544-10548.»  CrossRef  »  PubMed  »  Google Scholar

  8. Fischer CA, Zlobec I, Green E, Probst S, Storck C, et al. (2009) Is the improved prognosis of p16 positive oropharyngeal squamous cell carcinoma dependent of the treatment modality. Int J Cancer [Epub ahead of print]. »  CrossRef  »  PubMed  »  Google Scholar

  9. Gillison ML, Koch WM, Capone RB, Spafford M, Westra WH, et al. (2000) Evidence for a causal association between human papillomavirus and a subset of head and neck cancers. J Natl Cancer Inst 92: 675-677.»  CrossRef  »  PubMed  »  Google Scholar

  10. Hawley-Nelson P, Vousden KH, Hubbert NL, Lowy DR, Schiller JT (1989) HPV16 E6 and E7 proteins cooperate to immortalize human foreskin keratinocytes. EMBO J 8: 3905-3910. »  CrossRef  »  PubMed  »  Google Scholar

  11. Hays WL (1994) Inferences about population means. In: Statistics (5th edition). International Thomson Publishing 311-342.

  12. Herrero R, Castellsague X, Pawlita M, Lissowska J, Kee F, et al. (2003) Human papillomavirus and oral cancer: The International Agency for Research on Cancer multicenter study. J Natl Cancer Inst 95: 1772-1783. »  CrossRef  »  PubMed  »  Google Scholar

  13. Ho CY, Kim CF, Leung KN, Fung KP, Tse TF, et al. (2005) Differential anti-tumor activity of coriolus versicolor (Yunzhi) extract through p53- and/or Bcl-2-dependent apoptotic pathway in human breast cancer cells. Cancer Biol Ther 4: 638-644. »  CrossRef  »  PubMed  »  Google Scholar

  14. Jung AC, Briolat J, Millon R, de Reynies A, Rickman D, et al. (2009) Biological and clinical relevance of transcriptionnally active human papillomavirus (HPV) infection in oropharynx squamous cell carcinoma.
    Int J Cancer [Epub ahead of print].»  CrossRef  »  PubMed  »  Google Scholar

  15. Kan CY, Iacopetta BJ, Lawson JS, Whitaker NF (2005) Identification of human papillomavirus DNA sequences in human breast cancer. Br J Cancer 93: 946-948. »  CrossRef  »  PubMed  »  Google Scholar

  16. Khan NA, Castillo A, Koriyama C, Kijima Y, Umekita Y, et al. (2008) Human papillomavirus detected in female breast carcinomas in Japan. Br J Cancer 99: 408-414. »  CrossRef  »  PubMed  »  Google Scholar

  17. Kingsley K, Huff JL, Rust WL, Carroll K, Martinez AM, et al. (2002) ERK 1/2 mediates PDGF-BB stimulated vascular smooth muscle cell proliferation and migration on laminin-5. Biochem Biophys Res Commun 293: 1000-1006. »  CrossRef  »  PubMed  »  Google Scholar

  18. Kingsley K, Johnson D, O’Malley S (2006) Transfection of oral squamous cell carcinoma with human papillomavirus-16 induces proliferative and morphological changes in vitro. Cancer Cell Int 6: 14.»  CrossRef  »  PubMed  »  Google Scholar

  19. Kreimer AR, Cli fford GM, Boyle P, Franceschi S (2005) Human papillomavirus types in head and neck squamous cell carcinomas worldwide: a systematic review. Cancer Epidemiol Biomarkers Prev 14: 467- 475. »  CrossRef  »  PubMed  »  Google Scholar

  20. Kugu K, Ratts VS, Piquette GN, Tilly KI, Tao XJ, et al. (1998) Analysis of apoptosis and expression of bcl-2 gene family members in the human and baboon ovary. Cell Death Differ 5: 67-76. »  CrossRef  »  PubMed  »  Google Scholar

  21. Lawson JS, Tran D, Rawlinson WD (2001) From Bittner to Barr: a viral, diet and hormone breast cancer aetiology hypothesis. Breast Cancer Res 3: 81-85. »  CrossRef  »  PubMed  »  Google Scholar

  22. Lawson JS, Gunzburg WH, Whitaker NJ (2006) Viruses and human breast cancer. Future Microbiol 1: 33-51.  »  PubMed  »  Google Scholar

  23. Lee KH, Yim EK, Kim CJ, Namkoong SE, Um SJ, et al. (2005) Proteomic analysis of anti-cancer effects by paclitaxel treatment in cervical cancer cells. Gynecol Oncol 98: 45-53.2-433. »  CrossRef  »  PubMed  »  Google Scholar

  24. Mahoney MC, Bevers T, Linos E, Willett WC (2008) Opportunities and strategies for breast cancer prevention through risk reduction. CA Cancer J Clin 58: 347-71. »  CrossRef  »  PubMed  »  Google Scholar

  25. Moody CA, Fradet-Tucotte A, Archambault J, Laimins LA (2007) Human papillomaviruses activate caspases upon epithelial differentiation to induce viral genome amplification. Proc Natl Acad Sci USA 104: 29541- 19546. »  CrossRef  »  PubMed  »  Google Scholar

  26. Munoz N, Bosch FX, de Sanjose S, Herrero R, Castellsaque X, et al. (2003) Epidemiologic classification of human papillomavirus types associated with cervical cancer. N Engl J Med 348: 518-527. »  CrossRef  »  PubMed  »  Google Scholar

  27. Parssinen J, Alarmo EL, Karhu R, Kallioniemi A (2008) PPM1D silencing by RNA interference inhibits proliferation and induces apoptosis in breast cancer cell lines with wild-type p53. Cancer Genet Cytogenet 182: 33-39. »  CrossRef  »  PubMed  »  Google Scholar

  28. Plopper GE, McNamee HP, Bojanowski K, Ingber DE (1995) Convergence of integrin and growth factor receptor signaling pathways within the focal adhesion complex. Mol Biol Cell 6: 349-1365.»  CrossRef  »  PubMed  »  Google Scholar

  29. Reddout N, Christensen T, Bunnell A, Jensen D, Johnson D, et al. (2007) High risk HPV types 18 and 16 are potent modulators of oral squamous cell carcinoma phenotypes in vitro. Infect Agent Cancer 2: 21. »  CrossRef  »  PubMed  »  Google Scholar

  30. Ruiz-Ruiz C, Ruiz de Almodovar C, Rodriguez A, Ortiz-Ferron G, Redondo JM, et al. (2004) The up-regulation of human caspase-8 by interferongamma in breast tumor cells requires the induction and action of the transcription factor interferon regulatory factor-1. J Biol Chem 279: 19712- 19720.»  CrossRef  »  PubMed  »  Google Scholar

  31. Scheffner M, Werness BA, Huibregtse JM (1990) The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63: 1129-1136. »  CrossRef  »  PubMed  »  Google Scholar

  32. Shin YC, Nakamura H, Liang X, Feng P, Chang H, et al. (2006) Inhibition of the ATM/p53 signal transduction pathway by Kaposi’s sarcomaassociated herpesvirus interferon regulatory factor I. J Virol 80: 2257-2266. »  CrossRef  »  PubMed  »  Google Scholar

  33. Singh M and Singh N (2008) Induction of apoptosis by hydrogen peroxide in HPV 16 positive human cervical cancer cells: involvement of mitochondrial pathway. Mol Cell Biochem 310: 57-65. »  CrossRef  »  PubMed  »  Google Scholar

  34. Smith JS, Lindsay L, Hoots B, Keys J, Franceschi S, et al. (2007) Human papillomavirus type distribution in invasive cervical cancer and high-grade cervical lesions: a meta-analysis update. Int J Cancer 121: 621-632. »  CrossRef  »  PubMed  »  Google Scholar

  35. Sun L, Zhang G, Li Z, Song T, Huang C, et al. (2008) In GFP with high risk HPV-18E6 fusion protein expressed 293T and MCF-7 cells, the endogenous wild-type p53 could be transiently phosphorylated at multiple sites. J Clin Exp Clin Cancer Res 27: 35. »  CrossRef  »  PubMed  »  Google Scholar

  36. Syrjanen S (2005) Human papillomavirus (HPV) in head and neck cancer. J Clin Virol 32: s59-66. »  CrossRef  »  PubMed  »  Google Scholar

  37. Tsai JH, Hsu CS, Tsai CH, Su JM, Liu YT, et al. (2007) Relationship between viral factors, axillary lymph node status and survival in breast cancer. J Cancer Res Clin Oncol 133: 13-21. »  CrossRef  »  PubMed  »  Google Scholar

  38. Vakifahmetoglu H, Olsson M, Orrenius S, Zhivotovsky B (2006) Functional connection between p53 and caspase-2 is essential for apoptosis induced by DNA damage. Oncogene 25: 5683-5692.»  CrossRef  »  PubMed  »  Google Scholar

  39. van Houten VM, Snijders PJ, van den Brekel MW, Kummer JA, Meijer CJ, et al. (2001) Biological evidence that human papillomaviruses are etiologically involved in a subgroup of head and neck squamous cell carcinomas. Int J Cancer 93: 232-235. »  CrossRef  »  PubMed  »  Google Scholar

  40. Wagner JE, Huff JL, Rust WL, Kingsley K, Plopper GE (2002) Perillyl alcohol inhibits breast cell migration without affecting cell adhesion. J Biomed Biotechnol 2: 136-140. »  CrossRef  »  PubMed  »  Google Scholar

  41. Walboomers JMM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, et al. (1999) Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 189: 12-19. »  CrossRef  »  PubMed  »  Google Scholar

  42. Werness BA, Levine AJ, Howley PM (1990) Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science 248: 76-79. »  CrossRef  »  PubMed  »  Google Scholar

  43. Wolter F, Turchanowa L, Stein J (2003) Resveratrol-induced modification of polyamine metabolism is accompanied by induction of c-Fos. Carcinogenesis 24: 469-474. »  CrossRef  »  PubMed  »  Google Scholar

  44. Yasmeen A, Bismar TA, Kandouz M, Foulkes WD, Desprez PY, et al. (2007) E6/E7 of HPV type 16 promotes cell invasion and metastasis of human breast cancer cells. Cell Cycle 6: 2038-2042. »  CrossRef  »  PubMed  »  Google Scholar

  45. Yasmeen A, Bismar TA, Dekhil H, Ricciardi R, Kassab A, et al. (2007) ErbB-2 receptor cooperates with E6/E7 oncoproteins of HPV type 16 in breast tumorigenesis. Cell Cycle 6: 2939-2943. »  CrossRef  »  PubMed  »  Google Scholar

 
 
 
This Article
DOWNLOAD
» XML (86 kB)
» PDF (966 kB)
» Citation
   
CONTRIBUTE
» Write a Response
» Read other Responses
» Publishing with OPG
   
SHARE
» E-mail This Article
» Print This Article
» Rights and Permissions
   
Share
EXPLORE
Related Article at
» Pubmed
» DOAJ
» Scholar Google
 
 
 
 
Untitled Document
| More
OMICS Publishing Group: An Open Access Publisher
OMICS Publishing Group is the member of/publishing partner of/source content provider to
All Published content, except where otherwise noted, is licensed under a Creative Commons Attribution License.