ISSN: 1948-5948
Journal of Microbial & Biochemical Technology
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
 
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Differential Colonization of Plant Parts by the Rumen Microbiota is likely to be due to Different Forage Chemistries

Sharon A Huws1*, Olga L Mayorga1,2, Michael K Theodorou1, Eun J Kim3, Alan H Cookson1, Charles J Newbold1 and Alison H Kingston-Smith1
1Institute of Biological, Environmental and Rural Sciences (IBERS), Aberystwyth University, Penglais campus, Aberystwyth, UK
2Centro de Investigación Tibaitatá, CORPOICA, Kilómetro 14 Via Mosquera (Cundinamarca), Colombia
3Department of Animal Science, Kyungpook National University, Sangju, Korea
Corresponding Author : Sharon A. Huws
Institute of Biological, Environmental and Rural Sciences (IBERS)
Aberystwyth University, Penglais campus, Aberystwyth, SY23 3FG, UK
Tel: +44 1970 823202
Fax: +44 1970 823155
E-mail: hnh@aber.ac.uk
Received January 20, 2014; Accepted February 03, 2014; Published February 07, 2014
Citation: Huws SA, Mayorga OL, Theodorou MK, Kim EJ, Cookson AH, et al. (2014) Differential Colonization of Plant Parts by the Rumen Microbiota is likely to be due to Different Forage Chemistries. J Microb Biochem Technol 6: 080-086. doi: 10.4172/1948-5948.1000126
Copyright: © 2014 Huws SA, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Related article at
DownloadPubmed DownloadScholar Google

Visit for more related articles at Journal of Microbial & Biochemical Technology

Abstract

In this experiment we investigated the hypothesis that heterogeneity of plant structures presents disparity in niches available for colonisation by the rumen microbiota resulting in differential colonisation. Fresh perennial ryegrass (PRG) stem and leaves were incubated in the presence of rumen bacteria under rumen-like conditions with incubations harvested at many time intervals up to 24 h. In vitro dry matter degradability (IVDMD) of stem material was lower than that of leaves at all harvesting times. Denaturing Gradient Gel Electrophoresis (DGGE) derived dendrograms, canonical analysis of principal coordinates (CAP) and PERMANOVA demonstrated that diversity of bacteria attached to PRG stem and leaf material was different at all harvesting times although QPCR data showed similar quantities of bacterial 16S rDNA on stem and leaf material at all harvesting times. Conversely, bacterial diversity on abaxial and adaxial leaf surfaces was similar, but 16S rDNA quantity differed with more 16S rDNA on the adaxial surface at all harvesting times. Image analysis of low temperature scanning electron microscopy (LTSEM) pictures confirmed that biofilm coverage on the adaxial surface was greater than the abaxial surface. We demonstrate that differing plant parts can affect attached bacterial diversity and/or 16S rDNA quantity present. This result is consistent with concepts of niche specialisation by the rumen microbiota. This observation is particularly relevant to understanding rumen plant-microbe interactions which is necessary for development of novel strategies for improving ruminant nutrient use efficiency.

Keywords
Colonisation; Rumen; Bacteria; Stem; Leaf; Abaxial; Adaxial; DGGE; QPCR
Introduction
With an ever increasing population and increased demands for ruminant products, the need to ensure future food security is paramount [1]. This presents a major challenge to find novel strategies to sustainably increase animal productivity. The main challenge for the livestock sector is increasing the conversion of plant to microbial protein within the rumen which is inefficient as only around 30% of ingested nitrogen is retained by the animal for meat and milk production [2-5]. Thus in pasture-based feeding systems the plant-microbe inter-actome is central for utilisation of plant nutrients [3,5,6]. Furthering our understanding of plant-microbe interactions during colonisation and plant degradation is expected to offer novel opportunities to improve ruminant nutrient use efficiency in order to sustainably increase meat and milk availability.
The ability of the rumen microbiota to attach in a timely manner to ingested forages in the rumen is central to ruminant nutrient use efficiency. Indeed, it is known that rumen microorganisms rapidly attach to recently ingested feed particles [7-13]. We have also demonstrated that not only does bacterial colonisation of fresh whole perennial ryegrass in the rumen occur within 15 minutes, but this is not a stable community with a change in the diversity of attached bacteria from primary to secondary attached communities occurring within 2 - 4 h of perennial ryegrass colonisation [13]. Rumen microorganisms colonising the surfaces of forages are confronted with highly variable physiochemical conditions including nutrient type and availability due to the heterogeneity of the plant material. This heterogeneity may affect microbial attachment and subsequent biofilm formation. Indeed, plant degradation within the rumen is known to be affected by the amount of cuticle, waxes or lignin and the degree of cross-linkage to other cell wall polymers within the plant [14,15]. McAllister et al. stated that rumen bacteria do not bind to the waxy cuticle of forage particles due to the difficulty in degrading these structures in order to access the plant nutrients [6]. Thus, bacterial attachment to different parts of the plant material may be different due to the differences in their surface chemistry.
We investigated the hypothesis that attachment of the rumen microbiota to plant material is affected by the physicochemical properties of forage structures. It has been documented that PRG stem and leaves differ chemically [16,17], and wax chemistry on abaxial and adaxial surfaces differ [18], nonetheless colonisation of PRG by the rumen microbiota is often investigated without taking into account that composition of different plant structures vary. These approaches often miss fundamental information on the interactions of key microbiota with various plant structures and the subsequent effect on degradation of various structures within the whole plant. Hence, the first experiment compared bacterial colonization of fresh perennial ryegrass stems and leaves and the second experiment assessed attachment of rumen bacteria to each side of the colonised leaf (abaxial versus adaxial). Knowledge of bacterial colonization of different parts of forage plants aids our understanding of bacterial niche preference. Increasing our knowledge of rumen plant-microbe interactions is paramount in order to develop novel strategies of improving ruminant nutrient use efficiency and ultimately ensure ruminant food security.
Materials and Methods
Growth and preparation of plant material
Perennial ryegrass, (Lolium perenne cv. Aberdart; PRG) was grown from seed in plastic seed trays (length 38 cm x width 24 cm x depth 5 cm) filled with compost (Levingtons general purpose). The trays were maintained in a greenhouse under natural irradiance with additional illumination provided during the winter months (minimum 8 h photoperiod) or in a growth cabinet (Sanyo, Osaka) with 16 h of light (irradiance ~300 μmol m-2s-1) per day. A temperature of 22/19°C day/ night was maintained and plants were watered twice a week.
In vitro incubations: stem and leaf colonisation
Following 6 weeks of growth the plant material was cut with scissors at 3 cm above soil level and divided into stems and leaves. Sub-samples of stems and leaves were frozen, freeze-dried and stored at -20°C for chemical analysis and bacterial profiling (0 h samples). Chemical analyses of stem and leaf samples were carried out as described in Huws et al. [19]. Subsequently, cut stem or leaves (1 cm; 7.5 g) were added to Duran bottles (250 mL) together with anaerobic incubation buffer (135 mL pre-warmed to 39ºC [20] and rumen fluid inoculum (15 mL, strained through 2 layers of muslin and held under CO2 at 39°C). Bottles were incubated in a horizontally rotating rack at 100 rpm and 39°C (Incubator-shaker, LA Engineering, UK). Incubations were set up in sextuplicate and the bottle contents were harvested at 0, 0.25, 0.5, 1, 2, 4, 8, 12 and 24 h. At each time interval the contents of three of the bottles contents were harvested individually by vacuum filtration through filter paper (11μm2 pore size; ®QL100, Fisher Scientific, Leicestershire, UK). Retained, colonised plant material was washed with phosphate buffered saline (PBS), frozen at -20°C, before freeze-drying and grinding followed by DNA extraction. At each time interval the contents of the remaining three bottles were oven dried and plant degradation was measured as % dry matter lost.
In vitro incubations: adaxial and abaxial colonisation
Following 6 weeks of growth the plant material was cut with scissors at 3 cm above soil level and leaves were harvested and cut into 1cm strips. The chopped grass was used as substrate for anaerobic batch cultures set up in Duran bottles (250 mL) using rumen fluid inoculum prepared as described above and incubated for 0, 2, 4, and 8 h. Following incubation, a set of six bottles were harvested at the designated times and split into two groups of three bottles. The first group of three bottles was used as positive controls for whole leaf colonisation; the leaf fragments from those bottles were collected by vacuum filtration through filter paper (11 μm2 pore size; ®QL100, Fisher Scientific, Leicestershire, UK), rinsed in PBS then frozen at -20°C before freeze-drying and grinding followed by DNA extraction. The second group of bottles was used to assess the quantity and diversity of rumen bacteria on each side of the colonised leaf. Essentially, at each time interval, abaxial and adaxial leaf surfaces (from 100 leaf fragments) were placed on 10 microscope slides (10 per slide) and silicone rubber spread across the leaf surfaces with a brush. The silicone rubber (Magnacrafty, Midhurst, UK) was mixed with catalyst (Trylon Ltd, Northants, UK) (7 parts of rubber: 1 part of catalyst) causing it to set in 30 to 60 min. A second microscope slide was placed on top of the set layer and slight pressure carefully applied to the upper slide to facilitate the adherence of epidermal and microbial cells to the rubber film, before leaving overnight at 4ºC. After setting overnight, the silicone rubber and accompanying epidermal cells and bacteria were removed from the unwanted side of the leaf fragments using forceps. The modified leaf blades were then washed with PBS, frozen at -20°C and then freeze dried and ground. This method enabled selective removal of the adaxial or abaxial surface, and thus quantification of the colonisation on the surface left behind on the leaf fragment. Effective removal was assessed by staining the latex film after removal from plant fragments using the fluorescent dye DiOC6 (3)-(3,3′-dihexyloxacarbocyanine iodide) (Sigma-Aldrich Company, Ltd., Dorset, UK) [21]. Removal of bacteria from leaf surfaces was also visually confirmed by low temperature scanning electron microscopy of stripped unwanted surfaces as described by Huws et al. [13] (data not shown).
DNA extraction and denaturing gradient gel electrophoresis
DNA extraction, PCR-DGGE and subsequent gel fingerprinting, using the primers 799FGC(5’CGCCCGCCGCGCGCGGCGGGCGG GGCGGGGGCACGGGGGGAACAGGATTAGATACCCTG3’) and R1401 (5’CGGTGTGTACAAGACCC3’) was performed as described by Edwards et al. and Huws et al. [12,13]. Resultant DGGE gels were scanned using a GS-710 calibrated imaging densitometer (Bio-Rad UK Ltd, Hemel Hempstead, UK) and the saved image imported into the software package Fingerprinting (Bio-Rad UK Ltd, Hemel Hempstead, UK) for analysis. Cluster analysis was performed using Dice, with a position tolerance of 0.5% and optimisation parameter of 0.5%. The binary data generated from DGGE based fingerprinting was used to conduct canonical analysis of principal coordinates (CAP).
16S rDNA quantitative PCR
Total bacterial 16S rDNA quantitation using QPCR was performed as described by Huws et al. using the primers 520F (5’AGCAGCCGCGGTAAT3’) and 799R2 (5’CAGGGTATCTAATCCTGTT3’) [13]. The quantification was performed using a 7500 real-time PCR system (Applied Biosystems, Warrington, UK) using the same standards as described in Huws et al. [13]. Results were analysed using the 7500 SYSTEM SDS software (Applied Biosystems, Warrington, UK). QPCRs were performed in triplicate and assay PCR efficiency was calculated as follows: efficiency = 10(-1/slope) × 100. QPCR efficiency was always between 90-110%, and correlations of genomic DNA standards were >0.97.
Determination of biofilm coverage on abaxial and adaxial surfaces
To estimate the extent of coverage of biofilm communities on abaxial and adaxial leaf surfaces, four leaves (to allow examination of two adaxial and two abaxial surfaces) for each of three replicates at each incubation time were analysed by LTSEM as described by Huws et al. [13]. The LTSEM analysis was carried out by random scanning of surfaces at x 2200 magnification and a resolution of 10 μm at 3.0 kV. In total, 40 frames were analysed per surface and these were recorded as digital images using SEMAPHORE software. In total 120 digital images were processed using the digital image analysis software, NIH Image (Windows version available from Scion Corporation, U.S.A (http://www.scioncorp.com). The digital images were converted to threshold images, and particle size analysis was subsequently carried out to count and measure the biofilm coverage. The area of particles was computed, and size and coverage of biofilms quantified in pixels. The analysis was carried out on particle sizes ranging from 1 to 999999 square pixels. The area covered by biofilms in the randomly selected frames was measured as the percentage of pixels detected relative to the area of the measurement frame (total area of 2015544 square pixels per frame).
Statistical analysis
For IVDMD, QPCR and biofilm coverage data, two-way analysis of variance (ANOVA) was conducted and differences among means were determined by Duncan’s multiple range tests [22] using Gen Stat (Tenth Edition, VSN International Ltd., Hemel Hemstead, UK) [23]. For plant composition data, one-way analysis of variance (ANOVA) was conducted and differences among means were determined by Duncan’s multiple range tests [22] using Gen Stat. Primer 6 and PERMANOVA+ (version 6; Primer-E, Ivy bridge, UK) respectively were used to conduct canonical analysis of principal coordinates (CAP) [24] and permutation multivariate analysis of variance (PERMANOVA) [25] on DGGE generated binary data.
Results
Plant dry matter (DM) and chemical composition
DM did not vary significantly between stem and leaf material (P>0.05) (Table 1). Nonetheless, chemical compositional differences were found between stem and leaf in terms total nitrogen, water soluble carbohydrate (WSC) neutral-detergent fibre (NDF), acid-detergent lignin (ADL), and alkanes/lipid content (Table 1). Specifically, the stem contained significantly (P<0.001) more WSC, NDF and ADL but significantly less total nitrogen than the leaf.
In vitro dry matter degradation
IVDMD was significantly different (P <0.001) between leaf and stem incubations (Table 2). Leaf material was degraded to a greater extent than stem material with 69.2 and 58.9% being degraded for leaf and stem material respectively after 24 h incubation (Table 2). Degradation of leaf was also far more rapid than stem material with 32.2 and 9.1% being degraded for leaf and stem material respectively after 2 h of incubation (Table 2).
Attached bacterial diversity
PCR-DGGE derived UPGMA dendrograms revealed that the microbiota attached to either stem or leaf were markedly different at each incubation time (Figure 1A; maximum similarity 40%). As sample number exceeded gel capacity and comparisons between different DGGE gels are challenging, multiple gels were run in order to analyse all samples. Figure 1A shows a representative DGGE gel for one replicate of the three taken. Some sub-clustering of attached bacteria was also evident for stem and leaf attached microbiota between 2 and 4 h of colonisation (Figure 1A; maximum similarity was 40 and 55% between 2 and 4 h leaf and stem attached microbiota respectively). Canonical analysis of principal coordinates (CAP) ordination confirmed data for the PCR-DGGE derived UPGMA dendrograms (Figure 1B) by illustrating that the complexity of microbiota adhering to stem and leaves differed at each time point, but the 2 to 4 h differences are not so clear from these graphs. PERMANOVA supported the graphical data and showed that in the presence of stem or leaf material the attached microbiota differed significantly from each other (P>0.001, Pseudo-F=4.00).
PCR-DGGE derived UPGMA dendrograms revealed that the microbiota attached to either abaxial or adaxial leaf surface did not differ markedly at any of the time intervals (Figure 2A). Canonical analysis of principal coordinates (CAP) ordination confirmed data for the PCR-DGGE derived UPGMA dendrograms (Figure 2B) by showing similarity in the bacterial 16SrDNA diversity colonising the abaxial and adaxial leaf surface. Regardless of leaf surface there was discrimination between populations according to the duration of incubation (Figure 2B). PERMANOVA also confirmed that bacteria colonising abaxial and adaxial leaf surfaces did not differ significantly (P=0.75, Pseudo-F=0.68).
Attached bacterial quantity
The microbiota attached to stem and leaf were not different from each other in terms of 16S rDNA quantities (Table 3). Nonetheless, time had a significant effect on quantities of 16S rDNA determined on both stem and leaf , with 3.0 and 3.1 x times as much attached bacterial 16S rDNA present following 24 h of incubation on leaf and stem material respectively, compared to initial 16S rDNA quantities (Table 3).
Conversely, abaxial and adaxial attached microbiotas were significantly different from each other in terms of 16S rDNA quantities (Table 4). After 8 h of incubation bacterial 16S rDNA quantity was greatest on the adaxial surface compared with the abaxial surface with 2.2 and 3.2 ng g-1 RDM bacterial 16S rDNA present on the abaxial and adaxial leaf surfaces respectively (Table 4). When added together abaxial and adaxial 16S rDNA quantities were equal to, or at least very close, to the data obtained for whole leaves, thus showing that the stripping methodology was very effective (Table 4). Fluorescent dye DiOC6 (3)-(3,3′-dihexyloxacarbocyanine iodide) staining of leaf surfaces post stripping as well as LTSEM also confirmed the absence of bacteria on stripped surfaces (data not shown). No effect of time was identified in terms of 16S rDNA abundance regardless of leaf surface.
Biofilm coverage
Biofilm coverage data was in agreement with 16S rDNA QPCR data in showing that adaxial surfaces had a greater coverage of attached bacteria than abaxial surfaces (Table 5). Following 1h of incubation the abaxial surface had 40.6% coverage whilst the adaxial surface had 74.2% coverage (Table 5). By 8h the differential had decreased with the abaxial surface having 65.9% coverage and the adaxial surface 77.1% (Table 5). 0h data showed very little colonisation by plant epiphytic communities (data not shown).
Discussion
Increasing the efficiency of feed degradation is a key target for ruminant bioscience. Central to this target is efficient fermentation of forage, which requires rapid and effective colonisation of newly ingested feed by rumen bacteria to drive fibre degradation. In this study we investigated the hypothesis that attachment of the rumen microbiota to plant material is affected by the physicochemical properties of forage structures. Within this study we demonstrate that differing plant parts can have a profound effect on attached bacterial diversity and/ or 16S rDNA quantity. Colonisation of forages by rumen microbiota is commonly investigated without consideration of the effects of different plant structures on attachment of the microbiota, and likewise chemical composition of perennial ryegrass is often assessed using the whole plant. These approaches often miss fundamental information on the interactions of key microbiota with various plant structures and the subsequent effect on degradation of various structures within the whole plant. The heterogeneity of forage degradation has previously been shown in Lotus, where tannin containing cells were under graded by the rumen microbiota [26]. This study aids our understanding of niche specialisation of the attached rumen microbiota related to plant chemistry and thereby contributes towards developing novel strategies of improving ruminant nutrient use efficiency to ensure food security.
Stem material had more fibre and lignin content than leaves, which means that this part of the plant is potentially more difficult for the rumen microbiota to digest. Chemical composition data for stem and leaves in this study are similar to those reported previously [27,28]. This differential in recalcitrant cell wall structure between stem and leaves is the most likely explanation for the reduced IVDMD of stem material compared to leaves. Indeed, Chaves et al. also reported that DM degradability for leaf is higher than for stem material for perennial ryegrass, tall fescue, Yorkshire fog, Phalaris and Paspalum grass species [27].
PCR-DGGE derived UPGMA dendrograms, CAP analysis and PERMANOVA revealed that microbiota attached to the stem and leaf was markedly different from each other at all incubation times. QPCR data showed that although diversity of the attached bacteria was different, bacterial 16S rDNA quantity did not differ in the presence of stem or leaf material. Shinkai et al. also noted using fluorescence in situ hybridization (FISH) and QPCR, that more Fibrobacter succinogenes and Ruminococcus flavefaciens associated with leaves compared to stems of orchard grass hay [29]. Also noteworthy is the fact that shifts in attached bacterial diversity occurred between 2 and 4 h incubation on both stem and leaf material. Indeed, we previously noted this change from primary to secondary colonisation between these time intervals [13]. We therefore predict that this differential preference in colonization behaviour could underlie observed differences in degradation of leaf and stem material if it is associated with differential functionalities. This would require more detailed investigation such as RNA seq to confirm this hypothesis.
Bacterial communities of abaxial and adaxial leaf surfaces were similar, but QPCR and quantitative LTSEM data showed that more bacteria colonised the adaxial surface compared to the abaxial surface. There are currently few reports regarding differential bacterial diversity on the adaxial and abaxial surfaces of fresh perennial ryegrass. Akin found different morphological types of rumen bacteria on different plant surfaces by electronic microscopy [30]. Results from studies with mixed bacterial cultures have also shown differences in the attachment of rumen bacteria to plant cell types e.g. Bacteroides but not Ruminococcus adhered to intact mesophyll cell wall [31]. It has been suggested that distinct rumen bacterial species probably colonise plant surfaces in different ways, due to their distinct growth and survival requirements [32]. This differential in microbiota attached to abaxial and adaxial surfaces of perennial ryegrass may be due to differential chemo-attraction and physical barrier effects described in early studies [33-35] or differential electrostatic interactions that could be present on different sides of the leaf [36]. Adaxial surfaces have been reported to have more waxes containing long-chain alkanes, alcohols, ketones, and fatty acids as compared to the abaxial surface [36,37]. Therefore, the hydrophobicity of the cell surface may be important in adhesion as hydrophobic interactions tend to increase with the increasing non-polar nature of one or both surfaces involved i.e., the microbial cell surface and the substratum surface [8,38,39]. Most bacteria are negatively charged but still contain hydrophobic surface components [40,41], for instance, F. succinogenes cells adhere better to cationic cellulose ethers than neutral crystalline cellulose, whereas anionic cellulose-ethers reduced adhesion of this bacterium [8,42]. The adaxial surface has also been reported to have more stomata present, which have been reported as easy bacterial plant entry structures for subsequent plant degradation [7,43]. Irrespective, it appears that rumen bacteria colonise perennial ryegrass adaxial surfaces to a greater extent than colonisation of abaxial surfaces.
In summary we demonstrate that differing plant structures can have a profound effect on attached bacterial diversity and/or 16S rDNA quantity likely due to their differing chemistry. This suggests that the rumen microbiota display niche specialisation in terms of plant degradation. This data illustrates the importance of investigating intra-plant colonisation to get a deeper fundamental understanding of the plant-microbe interactome. Furthering our understanding of the ruminal plant-microbe interactome, in particular how the plant cell can be optimised through plant breeding to deliver nutrients in a manner suitable to maximise microbial efficiency [5], is fundamental to the development of novel strategies to increase ruminant production in order to meet increasing demand for meat and milk.
Acknowledgements
We acknowledge funding from COLCIENCIAS, CORPOICA (Colombia) and the Biotechnology and Biological Sciences Research Council (BBSRC, UK). We are also grateful to Mark Scott for his technical assistance in setting up the experiments. The authors have no conflict of interest.
References











































Select your language of interest to view the total content in your interested language
 
Share This Article
   
 
   
 
Relevant Topics
Disc Advanced Bioprocess Products
Disc Advances in Bioprocess Technology
Disc Advances in Biotechniques
Disc Advances in Food Bioprocess Technology
Disc Affinity Purification
Disc Agricultural
Disc Agricultural biotechnology
Disc Anaerobic Biodegradation
Disc Analytical Chromatography
Disc Animal and Plant Nutrition
Disc Animal biotechnology
Disc Anthrax
Disc Anti-parasitic Agents
Disc Antibacterial Agents
Disc Antibodies
Disc Antifungal Agents
Disc Antimicrobial Chemotherapy
Disc Antimicrobial Drugs
Disc Antimicrobial Peptide
Disc Antimicrobial Research
Disc Antimicrobial Resistance
Disc Antiprotozoals
Disc Antiseptics
Disc Antiviral Agents
Disc Applied Biotechnology
Disc Aseptic processing
Disc Bacteraemia
Disc Bacterial Ecology
Disc Bacterial Genomics
Disc Bacterial Infections
Disc Bacterial Toxin
Disc Bactericidal Drugs
Disc Bacteriology
Disc Bacteriostatic Drugs
Disc Beneficial Microorganisms in Food
Disc Beverage Industry
Disc Biocatalysis
Disc Biochemical Methods
Disc Biochemical Process
Disc Biochemistry
Disc Biodegradable Balloons
Disc Biodegradable Confetti
Disc Biodegradable Diapers
Disc Biodegradable Plastics
Disc Biodegradable Sunscreen
Disc Biodegradation
Disc Biofertilizers Technology
Disc Biological Activity
Disc Biomaterial implants
Disc Biomedical Chromatography
Disc Biomolecules
Disc Bioprocess Engineering
Disc Bioprocess Industry and Market Analysis
Disc Bioprocess Manufacturing
Disc Bioprocess Modelling
Disc Bioprocess and Systems Engineering
Disc Bioprocessing and Biopharma Manufacturing
Disc Bioremediation Bacteria
Disc Bioremediation Oil Spills
Disc Bioremediation Plants
Disc Bioremediation Products
Disc Biotechnology applications
Disc Blood Biochemistry
Disc Cancer Progression and Diagnostics
Disc Capillary Electrochromatography
Disc Carbohydrate Metabolism
Disc Carbohydrates Biochemistry
Disc Cardiac Markers
Disc Cardiovascular biomaterials
Disc Cellular and molecular Biochemistry
Disc Chromatography
Disc Clinical Biochemistry
Disc Clinical Chemistry
Disc Clinical Microbiology
Disc Coagulase Test
Disc Contamination
Disc Decomposers
Disc Deuterium Exchange Mass Spectrometry
Disc Diagnosis
Disc Diagnosis and treatment of Infectious Disease
Disc Diagnostics
Disc Electrolytes
Disc Electron Capture Dissociation Mass Spectroscopy
Disc Electrophoresis
Disc Electrospray Tandem Mass Spectrometry Newborn Screening
Disc Enzyme Technology
Disc Escherichia coli
Disc Ex Situ Bioremediation
Disc Experimental Food Microbiology
Disc Extraction Chromatography
Disc Fermentation
Disc Fermentation Industrial Microbiology
Disc Filtration
Disc Fishery biochemistry
Disc Food Additives
Disc Food Adulteration
Disc Food Allergens
Disc Food Biochemistry
Disc Food Borne Diseases
Disc Food Contamination
Disc Food Hazards
Disc Food Hygiene
Disc Food Hygiene Regulations
Disc Food Intoxication
Disc Food Labeling
Disc Food Microbes
Disc Food Microbiology
Disc Food Poisoning
Disc Food Quality Assurance
Disc Food Regulations
Disc Food Research International Standards (Food Research Europe, Food Research USA)
Disc Food Safety
Disc Food Safety and Quality
Disc Food Spoilage
Disc Food allergies
Disc Food and Beverage Technology
Disc Food and Feed Chemistry
Disc Food industry
Disc Food poison
Disc Food preservation
Disc Food science technology
Disc Fourier Transform Mass Spectrometry
Disc GC-MS
Disc Gas Chromatography
Disc Gas Chromatography Mass Spectrometry
Disc Genetic Diagnostics
Disc Genetic Testing
Disc Genomics in Infectious Diseases
Disc Germ cell tumours
Disc Good nutrition
Disc HPLC
Disc HPTLC
Disc Heavy Metal Bioremediation
Disc Host-Pathogen Interactions
Disc Imaging Mass Spectrometry
Disc Immuno Affinity Chromatography
Disc In Situ Bioremediation
Disc Industrial Bioprocessing
Disc Industrial Food Microbiology
Disc Industrial Microbiology
Disc Infection Control
Disc Inorganic Chemistry
Disc Inorganic biochemistry
Disc Intestinal Parasites
Disc Ion-exchange chromatography
Disc LC-MS
Disc Leprosy
Disc Liquid Chromatography
Disc Liquid Chromatography Mass Spectrometry
Disc Liquid Liquid Extraction
Disc Listeriosis
Disc Liver Diseases
Disc Liver Function Tests
Disc Lyme Disease
Disc MALDI
Disc Market Analysis of Food Testing
Disc Mass Spectrometry
Disc Mass Spectrometry Based Quantitative Metabolomics
Disc Mass Spectrometry in Medicine
Disc Mass Spectroscopy in Forensic Studies
Disc Medical Biochemistry
Disc Membrane Biochemistry
Disc Metabolites
Disc Method Validation
Disc Microbial Assay
Disc Microbial Assay of Antibiotic
Disc Microbial Biofuels
Disc Microbial Biosensor
Disc Microbial Fermentation
Disc Microbial Nutrition
Disc Microbiology
Disc Microbiology and Immunology
Disc Microbiology and Immunology Research
Disc Microbiology and Pathology
Disc Microorganism
Disc Minimum Inhibitory Concentration
Disc Molecular Diagnostics
Disc Molecular Forensics
Disc Morphology
Disc Multi Parametric Molecular Diagnostics
Disc Mycobacterium
Disc Mycology
Disc Mycoremediation
Disc Nano Chemistry
Disc Nano biotechnology
Disc Non Biodegradable
Disc Parasitic Infection
Disc Parasitic Worms
Disc Parasitology
Disc Pasteurisation
Disc Pathogen
Disc Pesticides
Disc Pesticides Biochemistry
Disc Petrochemistry
Disc Pharmaceutical Bioprocessing
Disc Phytoremediation
Disc Pigments
Disc Preparative Biochemistry
Disc Prevention of Contamination
Disc Principles of Diagnosis
Disc Protein Biochemistry
Disc Protein Folding by Mass Spectrometry
Disc Protein Mass Spectrometry
Disc Protein Purification
Disc Renal Function Test
Disc Rickettsioses
Disc Safe Food Handling Practices
Disc Salmonella
Disc Salmonellosis
Disc Selective Pressure
Disc Selective Toxicity
Disc Separation Techniques
Disc Sewage Water Treatment
Disc Soil Biochemistry
Disc Soil Bioremediation
Disc Soil organism
Disc Stem Cell Bioprocessing
Disc Sterilization
Disc Streptococcus
Disc Super Critical Fluid Chromatography
Disc Synthetic High Polymers
Disc Tandem Mass Spectrometry
Disc Transformation
Disc Types of Upwelling
Disc Ultrasound Technologies in Food Industry
Disc Virology
Disc Waste Degredation
Disc White/industrial biotechnology
Disc Xenobiotics
Disc Zoonotic Bacterial Diseases
Disc clinical Microbial Pathology
 
Recommended Journals
Disc Antimicrobial Agents Journal
Disc Molecular Diagnostics Journal
Disc Medical Biochemistry Journal
Disc Industrial Chemistry Journal
Disc Mass Spectrometry Journal
Disc Chromatography Journal
Disc Molecular Biology Journal
Disc Bioprocessing Journal
Disc Analytical Biochemistry Journal
Disc Food Microbiology Journal
Disc Industrial Microbiology Journal
Disc Biotechnology Journal
Disc Bioremediation Journal
Disc Bacteriology Journal
Disc Medical Microbiology Journal
  View More»
 
Recommended Conferences
Disc Water Microbiology Congress
July 18-20, 2016, Chicago, USA
Disc Veterinary Microbiology Summit
July 18-20, 2016, Chicago, USA
Disc Industrial Microbiology Conference
Aug 1-3, 2016, Frankfurt, Germany
Disc 6th Clinical Microbiology and Microbial Genomics Congress
Oct 24-26, 2016, Rome, Italy
Disc  7th World Congress and Expo onApplied Microbiology
Nov 10-12, 2016, Istanbul, Turkey
View More»
 
Article Tools
Disc Export citation
Disc Share/Blog this article
 
Article usage
  Total views: 11207
  [From(publication date):
March-2014 - Jun 25, 2016]
  Breakdown by view type
  HTML page views : 7479
  PDF downloads :3728
 
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

 
OMICS International Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
 
 
OMICS International Conferences 2016-17
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings
 
 

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

agrifoodaquavet@omicsinc.com

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

clinical_biochem@omicsinc.com

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

business@omicsinc.com

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

chemicaleng_chemistry@omicsinc.com

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

environmentalsci@omicsinc.com

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

engineering@omicsinc.com

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

generalsci_healthcare@omicsinc.com

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

genetics_molbio@omicsinc.com

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

immuno_microbio@omicsinc.com

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

omics@omicsinc.com

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

materialsci@omicsinc.com

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

mathematics_physics@omicsinc.com

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

medical@omicsinc.com

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

neuro_psychology@omicsinc.com

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

pharma@omicsinc.com

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

social_politicalsci@omicsinc.com

1-702-714-7001 Extn: 9042

 
© 2008-2016 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version