Primer Type Position on gene Length Sequence(5′-3′)
F Forward 701-720 20 mer GTCTTATGAGCAACGGGATG
B Backward 867-887 21 mer GAACATGACCTGATTAGTGTG
F3 Forward outer 387-405 19 mer TGCAGTCCGTTGAGGAAAC
B3 Backward outer 598-617 19 mer CCTGTACGTCCATGATCGTC
FIP Forward inner 453-473 and 413-431 40 mer AGTCACGGGCCCTTACAACAGCCCAATACATTGGGCCACG
BIP Backward  inner 515-534 and 564-581 37 mer TCGAAGGTTCGCCGAAGGCGACAATGGGGACAGCAGC
Table 1: Oligonucleotide primers used for LAMP and PCR of SF gene of TYLCV.