Primer Type Position on gene Length of primer Length of product Sequence(5'-3')
Forward Forward outer 85-104 20 nt 336 bp CGCGCTAACAGAGTTCAGCC
Backward Backward outer 420-401 20 nt   GCAATGGGGGTCCAACTCAT
F3 Forward outer 61-78 18 nt   AGAAGGCAATCCCTTCGC
B3 Backward outer 245-264 20 nt   GGTGAAACTTCCTTGGGTGT
FIP Forward inner 139-159 and 79-96 43 nt 163 bp GCCTCCTCTTCTGCGTCTTCGTTTTAGGCGCGCTAACAGAGTT
BIP Backward inner 161-182 and 223-241 45 nt   ATCGCCGCTCAAGAAGAACTGGTTTTCCACGAGGTTGTCCTTTGT
LF Loop forward outer 97-118 22 nt   CCGTGACCATAACCACTGGCTG
LB Loop backward outer 191-210 20 nt   GAGGACGAGGCTCAAGCGAG
Table 1: Oligonucleotide primers used for RT-LAMP and RT-PCR of coat protein gene of PLRV. RT-PCR primers (forward and backward) were designed by Oligo7 software that amplifies a 336 bp fragment. RT-LAMP primers (F3, B3, FIP, BIP, LF and LB) were designed by PrimerExplorer V.3 that produced many fragments with different sizes from which the smallest fragment was 163 bp in size.