Name

Primer/Probe

Sequence (5’-3’)

Genebank Accession

Aggrecan

Forward

GCCACTGTTACCGCCACTT

X60107

Reverse

CACTGGCTCTCTGCATCCA

Probe

CTGACCGGGCGACCTG

Col II α1

Forward

TCCTGGCCTCGTGGGT

AF201724

Reverse

GGGATCCGGGAGAGCCA

Probe

CTCCCCTGGGAAACC

Col X α1

Forward

GGCCCGGCAGGTCATC

NM_001005153

Reverse

TGGGATGCCTTTTGGTCCTT

Probe

TCAGACCTGGTTCCCC

Sox9

Forward

TGGCAAGGCTGACCTGAAG

AF029696

Reverse

GCTCAGCTCGCCGATGT

Probe

CCCCATCGACTTCCGC

Table 1: TaqMan customized porcine marker gene primers and probes.