Gene Name

5’-sequence-3’

Product size

Accession number

RPLP0

Forward AATCTCCAGGGGCACCATT
Reverse   CGTTGGCTCCCACTTTGT

 

70

 

NM_001002

OCN

Forward AGCAAAGGTGCAGCCTTTGT
Reverse  GCGCCTGGGTCTCTTCACT

 

63

 

NM_000711

OPN

Forward GCCGACCAAGGAAAACTCACT
Reverse  GGCACAGGTGATGCCTAGGA

 

71

 

J04765

SOX9

Forward AAAGGCAACTCGTACCCAAATTT
Reverse  TGATTGGCCACAAGTGGGTAA

 

75

 

NM_000346

COL10A1

Forward CACGCAGAATCCATCTGAGAATAT
Reverse  GTTCAGCGTAAAACACTCCATGAA

 

92

 

NM_000493

PPARG

Forward CAGTGTGAATTACAGCAAACC
Reverse ACAGTGTATCAGTGAAGGAAT

 

100

 

NM_015869

AP2

Forward GGTGGTGGAATGCGTCATG
Reverse CAACGTCCCTTGGCTTATGC

 

71

 

NM_001442

OCT3/4

Forward GACAGGGGGAGGGGAGGAGCTAGG
Reverse CTTCCCTCCAACCAGTTGCCCAAAC

 

118

 

NM_002701

SOX2

Forward GGGAAATGGGAGGGGTGCAAAAGAGG
Reverse  TTGCGTGAGTGTGGATTGGTG

 

125

 

NM_003106

NANOG

Forward AAAGAATCTTCACCTATGCC
Reverse GAAGGAAGAGGAGAGACAGT

 

111

 

NM_024865

Table 3: Primers sequence for quantitative RT-PCR.