Name Sequence
1071FW 5´ tgggattagataccccactatgctt 3´ *
1255RV 5´ tttgctgaagatggcggtatata 3´
1207RV 5´ tctgtaatcgataaaccccgatc 3´
1282RV 5´ gatgaaggctacaaagtaagc 3´
(GC-clamp) 5´ gcgggcggcgcggggcgcgggcagggcggcgggggcgggc3’
*to which the 40 nucleotide GC-clamp is attached to its 5´end.
FW: Forward, RV: Reverse
Table 1: Sequence of oligonucleotides used for PCR amplification of mutation T1189C of the 12S rRNA gene.