| Pathogen |
Nucleotide sequences of primers |
(Bp) |
Reference |
| Anaplasma marginale |
MAR1bB2F: 5′-GCT CTA GCA GGT TAT GCG TC-3′ and MAR1bB2R: 5′-CTG CTT GGG AGA ATG CAC CT-3′, were based on Major surface protein–1β encoding gen |
265 |
[22] |
| Trypanosoma evansi |
TR3: 5′-GCGCGGATTCTTTGCAGACGA-3′ and TR4: 5′- TGC AGA CAC TGG AAT GTTACT-3', were derived from repetitive nucleotide sequences. |
257 |
[23] |
| Babesia bovis |
Bb1: 5′-TTTGGTATTTGTCTTGGTCAT -3′ and B. bovis Bb2: 5′- ACC ACT GTA GTC AAA CTCACC-3′, were derived from the sequence of the gene encoding the enzyme carbamoyl phosphate synthetase II. |
446 |
[24] |
| Babesia bigemina |
Bg3: TAG TTG TAT TTC AGC CTC GCG and Bg4: AAC ATC CAA GCA GCT AHT TAG, were based on their small subunit ribosomal RNA sequences. |
689 |
[25] |
| Theileria annulata |
In the case of T. annulata, the cytochrome b gene was selected and cytob1 primer set: Forward: 5′-ACT TTG GCC GTA ATG TTA AAC–3′/Reverse: 5′-CTC TGG ACC AAC TGT TTGG–3′ was used to amplify a 312 bp variable region. |
312 |
[26] |
| Theileria sp. |
989: 5′-AGT TTCTGA CCT ATC AG–3′ and 990: 5′- TTG CCT TAA ACT TCC TTG–3′, were based on their small subunit ribosomal RNA sequences. |
1100 |
[27] |
| Anaplasma marginale |
Am3: GTGGCAGACGGGTGAGTAATG A and Am4: CATGTCAAGAAGTGGTAAGGT, were derived from the sequence of the gene encoding the surface protein. |
160 |
[27] |
| Trypanosoma brucei |
TBR1.2F: 5'-GAA TAT TAA ACA ATG CGC AG-3' and TBR1.2R: 5ˋ-CCA TTT ATT AGC TTT GTT GC-3' were based on the highly repeated sequence of mini-chromosome satellite DNA. |
164 |
[28] |
