Sequence 5' - 3'
hSMP PCR 1F1                                     GGATTCAAGCAATTCTCCTGTCTCAGCC
hSMP XhO2 R                                      ACACTCGAGACAGTCTGGGCTTTCTCC
hSMP non ERE F                                   TGGAGAAAGCCCAGACTGTCAGAT
hSMP non ERE R                                    GGCTGGAAGAATCCTGCAAAG
Table 3: Primers Used in ChIP PCR.