Table A Hematologic responses Complete or major hematological response Partial or minor hematological response Loos or minimal hematological response Platelet count >150x 109/L WBC count < 10 x 109/L Basophils :< 5% Differential without immature granulocytes. Absence of blasts and promyelocytes in peripheral blood Spleen : nonpalpable spleen Platelet count <450 x 109/L WBC count >10 x 109/L Basophils :>10% Presence of blasts and promyelocytes in peripheral blood Spleen : Palpable spleen Platelet count < 450 x 109/L WBC count >20 x 109/L Basophils :15% Presence of blasts and promyelocytes in peripheral blood Spleen : Palpable spleen Table B Molecular response Major molecular response Minimal or No Molecular response It indicates nonquantifiable and nondetectable bcr-abl gene transcript (BCR-ABL/ABL) 0.103 3 log reduction of BCR-ABL/ABL It indicates quantifiable and detectable bcr-abl gene transcript (BCR-ABL/ABL) ≥0.103 No 3 log reduction of BCR-ABL/ABL C5e 5’ATAGGATCCTTTGCAACCGGGTCTGAA3’ B2B 5’ACAGAATTCCGCTGACCATCAATAAG3’ BCR-C 5’ ACCGCATGTTCCGGGACAAAAG3’ CA3 5’TGTTGACTGGCGTGATGTAGTTGCTTGG3’ Transcript primers used Size (bp) Control BCR B2B and C5e 808bp b2a2 B2B and CA3 310bp b3a2 B2B and CA3 385bp e1a2 BCR-C and CA3 481bp

Table 1: Sequence of oligonucleotides used in multiplex RT-PCR for detection of BCR-ABLtranscript as the target gene and BCR transcripts as the internal control.