Gene Sequences (5’-3’) Annealing Temperature (°C) PCR Products Size (bp)
PGK1 F GACCTAATGTCCAAAGCTGAGA 58 127
R A
CAGCAGGTATGCCAGAAGCC
DNMT1 F AACCTTCACCTAGCCCCAG 58 125
  R CTCATCCGATTTGGCTCTTTCA
DN MT3b F CCAATCCTGGAGGCTATCCG 60 152
  R ACTGGGGTGTCAGAGCCAT
MeCP2 F TGACCGGGGACCCATGTAT 58 145
  R CTCCACTTTAGAGCGAAAGGC
MBD3 F CAGCCGTGACCAAGATTACC 59 135
  R CTCCTCAGCAATGTCGAAGG
Table 1: Primer sets for real time PCR.