Set 1-Primer assay for SNP conformation
Gene Forward Reverse Product length Tm
CBLN2 TGTCTTTTCCAAGGGGATGA TTTGATGCATAACAGGCAACT 178 60
TTLL7 TGTAAGGTGGAGGCTTAGAGAAA ACACTCATGCACACACACACA 310 60
WDR40C (DCAF12L2) GTGGGAAGCAGTGGTAGGG AGCCCCAAAGTGGGTTTTAC 226 60
ATP2B3 AAGTGGTTGAGTGGGTGTCC AGAAGCCCCAAATGGACTTT 280 60
RAB39B CAAGGTCATTTTGGGGTGAG GGACAAAGGTAAAGCCCATTC 205 60
Set 2-Primer assay for qRT-PCR
Gene Forward Reverse Product length Tm
CBLN2 GCAAGTGCTTGGTGGTGTG AAATCCCTTTTCTCGGTGCT 243 60
TTLL7 ATGATGGACTTGTGCGAATG ACGTTTGCTGCCTTTGTTCT 152 60
WDR40C (DCAF12L2) CTGCGATGAGTTGTCCCTCT GGCTCTCTCCTCCAGGAACT 220 60
ATP2B3 TGACCTCACCTGCATAGCTG GGTTGAACTCCTTCCCTTCC 206 60
Set 3-Primer assay for coding variants
Gene Forward Reverse Product length Tm
CBLN2        
Exon 1 AACGACCCTGGCCTTGAC GAACTCCACGTCCAAGAAGC 596 60
Exon 2 ACTGAGGAGGGGCTTGCTAT CCAAACCTGAAAGGATCCAG 205 60
Exon 3 TGCTGAGCTCTACTCTCTGCAT CCACCATCTAGGGTGCTCTG 248 60
Table 4: Primer assays for 5 candidate genes in rhesus.