Gen  Primer Sequence  Probe
18s Fwd 5’ GCAATTATTCCCCATGAACG 3’
Rev 5’ GGCCTCACTAAACCATCCAA 3’
 
TNF Fwd 5’ GGAGAAGGGTGACCGACTCA 3’
Rev 5’ TGCCCAGACTCGGCAAAG 3’
CGCTGAGATCAATCGGCCCGACTA
IL-6 Fwd 5’ CCAGGAGCCCAGCTATGAAC 3’
Rev 5’ CCCAGGGAGAAGGCAACTG 3’
CCTTCTCCACAAGCGCCTTCGGT
LPL Fwd 5’ CCATGGCTGGACGGTAACAGGA 3’
Rev 5’ GCCCGCGGACACTGGGTAAT 3’
 
HSL Fwd 5’ CTCAGTGTGCTCTCCAAGTG 3’
Rev 5’ CACCCAGGCGGAAGTCTC 3’
 
FASN Fwd 5’ TGGTCACGGACGATGACCGTC 3’
Rev 5’ GGTTGATGCCTCCGTCCACGAT 3’
 
Adiponectin Fwd 5’ AAAACCTCCCCCAAGCAGAGCTTC 3’
Rev 5’ TGAGGAACAGGGATGAGTTCAGCA 3’
 
PPARγ Fwd 5’ CTTATCTATGACAGATGTGATCTT 3’
Rev 5’ GCTGGTCGATATCACTGGAGA 3’
 
Table 1: qPCR Primer sequences.