Target organism Primer Sequence (5' - 3') Size (bp) Conc. [pmol/µL] Reference
Lactic Acid Bacteria (LAB) Fwd primer AGC AGT SGG GAA TCT TCC A 352-700 4 [8]
Rev primer ATT YCA CCG CTA CAC ATG 4
BcoAT gene Fwd primer GCI GAI CAT TTC ACI TGG AAY WSI TGG CAY ATG ~540 27 [9]
Rev primer CCT GCC TTT GCA ATR TCI ACR AAN GC 27
Enterobacteria Fwd primer AGC ACC GGC TAA CTC CGT 492-509 3 [10]
Rev primer GAA GCC ACG CCT CAA GGG CAC AA 834 - 856 3 [11]
Prevotella Fwd primer CACCAAGGCGACGATCA 1458 2,5 [12]
Rev primer GGATAACGCCYGGACCT 2,5
Akkermansia Fwd primer CAGCACGTGAAGGTGGGGAC 1505 2,5 [13]
Rev primer CCTTGCGGTTGGCTTCAGAT 2,5
Table 3: Primers (SYBR® Green) targeting 16rRNA coding regions of bacteria and butyryl-coenzyme A (CoA) CoA transferase genes.