Gene

Approved symbol

Gene Bank accession number

 

Primer sequence

Tm (°C)

No. cycles

Product length (bp)

EGFR

EGFR

NM_005228.3

sense

CAGCAGAGACCCACACTACCAG

58

35

213

antisense

GAGCCCTTAAAGATGCCATTTG

Akt

AKT1

NM_005163.2

sense

ACAAGGACGGGCACATTAAGAT

62

35

189

antisense

GACCGCACATCATCTCGTACAT

PI3K

PIK3CA

NM_006218.2

sense

TGGTGAAAGACGATGGACAACT

54

35

151

antisense

GTGCATTCTTGGGCTCCTTTAC

PTEN

PTEN

NM_000314.4

sense

CAATCCTCAGTTTGTGGTCTGC

54

35

226

antisense

GGTTTCCTCTGGTCCTGGTATG

mTOR

MTOR

NM_004958.3

sense

GGGACTGCTTTGAGGTTGCTAT

56

35

249

antisense

ATCGCTTGTTGCCTTTGGTATT

Cyclin  D1

CCND1

NM_053056.2

sense

CCCCAACAACTTCCTGTCCTAC

60

35

186

antisense

ACCTCCTCCTCCTCCTCTTCCT

CDK4

CDK4

NM_000075.3

sense

CGAAACGATCAAGGATCTGATG

55

35

188

antisense

TAACAACCACGGGTGTAAGTGC

PCNA

PCNA

NM_002592.2

sense

TCAGCCATATTGGAGATGCTGT

55

35

228

antisense

GTGTCACCGTTGAAGAGAGTGG

RB

RB1

NM_000321.2

sense

CCCCTACCTTGTCACCAATACC

62

35

246

antisense

CACGGTCGCTGTTACATACCAT

E2F1

E2F1

NM_005225.2

sense

CGTGGACTCTTCGGAGAACTTT

58

35

187

antisense

AGATGATGGTGGTGGTGACACT

c-myc

MYC

NM_002467.4

sense

TCCACACATCAGCACAACTACG

58

35

171

antisense

GTGTGTTCGCCTCTTGACATTC

p53

TP53

NM_000546.4

sense

TTGGCTCTGACTGTACCACCAT

56

35

203

antisense

TTTCTTGCGGAGATTCTCTTCC

Collagen I

COL1A1

NM_000088.3

sense

CCAGAACATCACCTACCACTGC

60

35

218

antisense

GGGAGGTCTTGGTGGTTTTGTA

Collagen III

COL3A1

NM_000090.3

sense

TGCAAATTGGATGCTATCAAGG

56

35

205

antisense

GCACATCAAGGACATCTTCAGG

TGF β1

TGFB1

NM_000660.4

sense

ACAATTCCTGGCGATACCTCAG

58

35

196

antisense

GTAGTGAACCCGTTGATGTCCA

ILK

ILK

U40282.1

sense

GCATGGCTGATGTCAAGTTCTC

56

35

156

antisense

GTGTCACCAGTTCCCACAGAAG

Glut1

SLC2A1

NM_006516.2

sense

ACCCTGGATGTCCTATCTGAGC

58

35

360

antisense

TCCTCGGGTGTCTTGTCACTT

Insulin Receptor

INSR

M10051.1

sense

TGTCATGGATGGAGGGTATCTG

56

35

174

antisense

CTGTGGAAGAACGACACCTCTG

Hexokinase I

HK1

NM_000188.2

sense

CCTAAATGCTGGGAAACAAAGG

58

35

193

antisense

CAGTGCTAATCGGTCACTCTCG

Hexokinase II

HK2

NM_000189.4

sense

ACCAAGCGTGGACTACTCTTCC

58

35

156

antisense

ACAGGTGCTCTCAAGCCCTAAG

PFK

PFKP

NM_002627.4

sense

TGGAGTGGATCACTGCAAAACT

54

35

165

antisense

GTTCTTTGGGAATCCTGTGCTC

PKM1

PKM

NM_182470.2

sense

GAGCCTCAAGTCACTCCACAGA

58

35

227

antisense

CTTGCACAGCACAGGGAAGAT

PKM2

PKM

NM_002654.4

sense

AGAGGCTGCCATCTACCACTTG

58

35

150

antisense

CCAGACTTGGTGAGGACGATTA

PDH

PDHA1

NM_000284.3

sense

AAGAGAGGCGATTTCATTCCTG

56

35

248

antisense

TTCACCATCCTGTCCTTGAGAA

PDK4

PDK4

NM_002612.3

sense

TCCAGACCAACCAATTCACATC

56

35

194

antisense

GAACACCACCTCCTCTGTCTGA

FOXO1

FOXO1

NM_002015.3

sense

CCTGACCCAAGTGAAGACACCT

56

35

159

antisense

ATGAACATGCCATCCAAGTCAC

FOXO3

FOXO3

NM_001455.3

sense

CTCTCTCTCAGGCTCCTCCTTG

56

35

215

antisense

CCACGTTCAAACCAACAACATT

PPAR g

PPARG

NM_138712.3

sense

AGATGACAGCGACTTGGCAATA

56

35

207

antisense

TCCGTGACAATCTGTCTGAGGT

PGC1 α

PPARGC1A

NM_013261.3

sense

GCCGTGTGATTTATGTCGGTAA

56

35

237

antisense

GCTTGCGTCCACAAAAGTACAG

SIRT-1

SIRT1

NM_001142498.1

sense

GCAGATTAGTAGGCGGCTTGAT

56

35

153

antisense

CTCTGGCATGTCCCACTATCAC

Mn-SOD

SOD2

X14322.1

sense

CTGCATCTGTTGGTGTCCAAG

56

35

160

antisense

TAGTAAGCGTGCTCCCACACAT

HIF-1 α

HIF1A

NM_001530.3

sense

TACTCAAAGTCGGACAGCCTCA

54

35

179

antisense

TTCGCTTTCTCTGAGCATTCTG

TNF-α

TNF

NM_000594.3

sense

CCATGTTGTAGCAAACCCTCAA

58

35

155

antisense

CCTTGAAGAGGACCTGGGAGTA

18S

RNA18S1

M10098.1

sense

GTAACCCGTTGAACCCCATT

62

30

151

antisense

CCATCCAATCGGTAGTAGCG

Table 1: Genes investigated and amplification data