Table 1

Gene	Single nucleotide Polymorphism	PCR primers		Restriction enzyme	Fragment sizes
Gene	Single nucleotide Polymorphism	Name	Sequences (5’ to 3’)	Restriction enzyme	Fragment sizes
LMP2 (PSMB9)	CGC/CAC codon 60 (R60H)[11,42]	LMP2-2	GTGAACCGAGTGTTTGACAAGC	Hha1	G:212, 40 bp
	rs17587	LMP2-1	GCCAGCAAGAGCCGAAACAAG	37OC for 4 hours	A: 252 bp
LMP7 (PSMB8)	CAG/AAG codon 49 (Q49K)[11,42]	LMP7-Z	TCGCTTTACCCCGGGGACTGa	Pst1	C: 194, 18 bp
	rs2071543	LMP7-BR	AACTTGCACTTCCTCCTCTCAGG	37OC for 2 hours	A:212 bp
LMP7 (PSMB8)	G/T intron 6 [11,25]	LMP7-7	TTGATTGGCTTCCCGGTACTG	Hha1	G: 428,180,155bp
		LMP7-4	TCTACTACGTGGATGAACATGG	37OC for 5 hours	T:583,180 bp

* p value calculated using Fisher’s exact test
** Odds Ratio calculated using Woolf’s formula with Haldane’s modification
@ Haplotypes were made using SHEsis online software [19,20]
$ haplotypes showing significant differences are shown

Table 1: Primers used for amplification of LMP2 exon 3, LMP 7 Exon 2 and Intron 6 for SNP genotyping [11].