GENES GENE POLYMORPHISM PRIMER SEQUENCE PCR
 PRODUCT
RESTRICTION ENZYMES FRAGMENT SIZE
WILD/MUT/HET
PGC1 ALPHA
(rs8192678)
Gly482Ser 5’TATTTAGGGTTTTGCCAAGG3’
5’TTTGGAGGCAAGCAAGCAG3’
Annealing Temp: 58°C
508bp Msp1 508/376,132/508,376,132
IRS1
(rs 1801278)
G972R 5’CGAGGTGTCCACGTAGC3’
5’CTTCTGTCAGGTGTCCATCC3’
Annealing Temp: 50°C
260 bp BstN1 156,81,23/ 156,105,81,51,23/ 105,81,51,23
PI3 K
(rs 3730089)
Met326Ile 5’CCACAACGGTATGAATAACCATAT3’
5’CGAGATATCTCCCCAGTACC3’
Annealing Temp: 54°C
65bp Nde1 43,22/43,22,65/65
KCNJ11
(rs 5219)
E23K 5’GACTCTGCAGTGAGGCCCTA3’
5’AGAAAAGGAAGGCAGACGAGAAG3’
Annealing Temp: 58°C
218 bp BanII 178,40/178,40,218/218
Table 2: Depiction of Gene Polymorphism, Primer Sequence, Pcr Product, Annaeling Temp and Fragment Size.