Gene Forward primer sequence 5’-3’) Reverse primer sequence (5’-3’) Probe sequence (5’-3’)
StarD2 GGACCCCCGCATCCAT CGCTTTGAAGGTGGGAACA TGCTACACCAACTGAAGCTCGCCCTT
StarD4 CAGAGTCTCCTGACAGGCTACATC TGCTTGCCATTGCTGTGTCT ACAGACCTGCGTGGCATGATCCC
StarD5 GCATCACGGATACGCTGTGT CTGGGCGAATCAGCTTCAT CAGAACCTCCACGCCCTCAGCTG
StarD6 AAAAGAAGGTGCCATCTCAACAA CAGATGAAGCCAAGGGTGTCT TCTGGCTTCCACTGACCCAATGGC
StarD7 TGGAATGAGCAGTGAGGCTAA GCCACAGCTACCCTCATTCTTC CCACTGCTTCGTCCCCCGAGC
StarD8 CCTCACAAGCGAAGAGAATCTTG GGCCTCCAGATGCAGTAGCA AAGAAGATCGTTGCTGTCCACCTGACCA
StarD9 TTCAGTACCAGCCCCGTTGT CGCAAGAAAACCAGGAATCC CCGAACAAATCAACCCTCTCCGAGGTA
StarD10 TCCCCACGCTCTCTATGGAA GACACCTTCACGGCCCAAAG AGCCAGCTGCTTCAACAGAACCCCA
StarD11 AGACGAGTAGAGGAAGCATACAAGAAT TCAAGAACTCTTCCTCATTAATCAGACT AACCTCGCTTCGGAGGGCCAGACTAT
StarD12 GGGCAAACCAGACCAGAAG TGCACTCGGCAATCATGTG TCTGAATGAAAACCTAGCCGCCACTCA
StarD13 CAAGAAATCGAGGCGAAGGA TGTTGATGGGAAACTGCGAAT CTGCGAGCTGCCGGGTTCCC
StarD14 GCGCCGGCACATCAA CTTCTGAGGCTGGTCATCTTTGT AGCGCCTTCATGACTTTCGTGGTCC
StarD15 CGCCGGGCAACTACTTAAGT CAGGAATCCCAGCATGCTT ACTGCCTGCCTGGCCGCTGA
Gapdh CAACTACATGGTCTAGTTCCAGTATG CTTCCCATTCTCAGCCTTGACGT CTACCCACGGCAAGTTCAACGGCA
Table 1: Primer and probe sequences used to investigate gene expression of StarD proteins in samples of rodent liver.