Figure 7: Predicted YdcI-binding sites upstream of gltA,icd, and sdhC. Annotation of known regulatory sequences was derived from EcoCyc. (A) The predicted YdcI-binding site overlapped annotation of the regulatory region for gltA. The ArcA-binding site sequence is underlined in green (tcaacaaagttgtta), the predicted YdcI-binding site in red (aacattaccaggaaaag), and the promoter sequence in blue (taccaggaaaagcatataatgcgtaaaagt). (B) The predicted YdcIbinding site overlapped annotation of the regulatory region for icd. The sequence of the predicted YdcI-binding site is underlined in red (ttttgcatggtattttc), and that of the promoter sequence in blue (agagattatgaattgccgcattatagcctaata). (C) The predicted YdcI-binding site overlapped annotation of the regulatory region forsdhC. The sequence of the ArcA-binding site is underlined in green (ttgttgaatgattg), and that of the predicted YdcI binding site in red (cttttcctggtaatgtt).