Sl No. Gene Primer (5I- 3I) Annealing Temp. (oC) Size of Amplicon (bp) Putative bio-logical role Accession Number 1 EAAT F-cagtgtttggaaccctaa 56 139 Nutrient transporter XM_424930 R-gatggctttgtagatggc 2 FABP F-gcagaatgggaataagttc 55.7 256 Nutrient transporter NM_204192.3 R-cttgctaattctcttgtagg 3 SGLT F-tattatcctgcttgctat 46.1 173 Nutrient transporter AJ236903.1 R-cattcatatacttctccat 4 CDX F-ctcggacttcgccagctacc 54 296 Intestinal tract Dev. AB046532 R-tgcgcctcatccattcgtac 5 IL-6 F-gaaatccctcctcgccaatctga 57 281 Humoral immunity related genes NM001007079 R-tgaaacggaacaacactgccatct 6 TLR-2 F-gtggccatgtcgatcagcagaaac 56 202 Cellular immunity related genes NM_204278.1 R-  tcagcggagagtcacagatgtagc 7 GAPDH F-ccgtcctctctggcaaagtcc 57.5 266 House keeping NM_204305 R-agccccagccttctccatg

Cdx: Caudal Type Homeobox; FABP: Fatty Acid Binding Protein; SGLT: Sodium Dependent Glucose Transporter; EAAT3: Excitatory Amino Acid Transporter-3; IL-6: Interleukin-6; TLR-2: Tool Like Receptor-2 and GAPDH: Glyceraldehyde 3 Phosphate Dehydrogenase.

Table 1: Oligonucleotide sequence of intestinal developmental and nutrient transporter gene primers.