Species Primera Target Sequence (5’ to 3’) Accession-No.b qPCR annealing temperature and time Size of Amplicon (bp) Species-specific amplification, detection limit Universal primerpair UniLactoHsp60FOR1 UniLactoHsp60REV1 GroELc GroEL ATGGAAAAGGTTGGCCA [220-236] TCAGTTACCATGTATTGTGACA [323-344] - - 53°C, 30 s 124 - L. acidophilus LAcidophTaq3FOR GroEL FAMdTCGAAGATTCACGTGGTATCAATAC[254-278]Dabcyle AY424311   - - üf , n.t.g L. reuteri LReuteriTaq1FOR GroEL FAMCTCGTGGTGTTGACACTAGCG [263-283]Dabcyl AF429714 - - ü, >104

aFOR, Forward primer, REV, Reverse primer bAccession-No., NCBI-Accession-No. in NCBI database cGroEL, heat shock protein dFAM, 6-carboxyfluorescein reporter eDabcyl, Dabcyl quencher f√, species-specific amplification was possible using this primer in combination with universal primer set gn.t., not tested

Table 2: Lactobacillus species-specific primers based on GroEL gene.