Primer

Sequence

Product size

Annealing
temperature

PGK

For: 5’ TGCCTGTTGACTTTGTCACTGCTG 3’
Rev: 5’ AGCCTCAGCATACTTCTTGCTGCT 3’

112 bp

60° C

ADPF

For: 5’ AGCCCCTTACAGGCATAGGT 3’
Rev: 5’ GTGAGATGGCAGAGAACGGT 3’

121 bp

60° C

LEP

For: 5’ GTAGGAATCGCAGCGCC 3’
Rev: 3’ GGGCACACGTTGGACATAGA 3’

125 bp

60° C

PPAR-γ

For: 5’ CCAGAAAGCCATTCCTTCAC 3’
Rev: 3’ CGGAGCTGATCCCAAAGTT 3’

109 bp

60° C

SREBF1

For: 5’CAAATAGGCCAGGGAAGTCA 3’
Rev: 5’ACGAGCCACCCTTCAGC 3’

138 bp

60° C

ALP

For: 5’ CTA TCC TGG CTC CGT GTC C 3’
Rev: 5’ AGC CCA GAG ATG CAA TCG 3’

138 bp

60° C

COL I

For: 5’ CAT GTT CAG CTT TGT GGA CC 3’
Rev: 5’ TTC TGT ACG CAG GTG ATT GG 3’

107 bp

60° C

IBSP

For: 5’ GGG CAG TAG TGA CTC ATC CG 3’
Rev: 5’ TCA GCC TCA GAG TCT TCA TCT TC 3’

90 bp

60° C

ON

For: 5’ GAGAAAGAAGATCCAGGCCC 3’
Rev: 5’ GCCTGTCTCAAACCCCTCC 3’

126 bp

60° C

Table 1: Primers list. List of the primers used in real-time quantitative RT-PCR.