Gene

Primer

Primer Sequence

Size

Aggrecan Can-Agg F 5’ GATTGAAGTCAGTGGAGACC 3’ 5991~ 236 bp
Can-Agg R 5’ CTGACTCATCTGTCCCTGAT 3’ ~6226
Col I a1 Can-C1A1 F 5’ AACATGGAGACAGGTGAGAC 3’ 3950~ 235 bp
Can-C1A1 R 5’ AGTGGTAGGTGATGTTCTGG 3’ ~4184
Col II a1 Can-C2A1 F 5’ TACTGTTCTGAAGGATGGCT 3’ 4313~ 243 bp
Can-C2A1 R 5’ GTGACTGGGACTGGAAAGTA 3’ ~4555
GAPDH Can-GAPDH F 5’ CCAGTATGATTCTACCCACG 3’ 135~ 234 bp
Can-GAPDH R 5’ GAAGGAGCAGAGATGATGAC 3’ ~368
Table 1: Primers and primer sequences.