Gene Forward Primer Reverse Primer Reference
16S CGGGGAGGAAGGTGTTGTG GAGCCCGGGGATTTCACATC [25]
floR CCACAATTTGGCTGTGATGGCTCA TGGTCGTGTTATTAGCGGCCAGAT [26]
hilA CGCTGGCAGAATGCTACCTC AGCCCCAGTAATCCTAAAGCTTG This study
sopB CGTTGTGCGAGTTTATAGGG GAGGTCGTCAATACATTAGCG This study
pnp TGAACCAGACCTTCTTTCC GAGATCACCGCAGAGATC This study
Table 1: Real-time PCR primers (5’-3’).