Name Sequence (5′-3′)
S1-F TGTTCTGTCCTATCGCAACG
S1- R ACGGATGCAGTTCCTTTCTG
S2 -F TCTTCCCAGACGTGGATTTC
S2-R CTCGACAATACGCTGCTTGA
Longicin-F CAAGATGACGAGAGT
Longicin-R CTACTTGCGGTAGCAC
Longicin Bam HI-F ACGGATCCCCAAGATGACGAGAGT
Longicin Bam HI-R ACGGATCCCTACTTGCGGTAGCAC
Actin-F CCAACAGGGAGAAGATGACG
Actin-R ACAGGTCCTTACGGATGTCC
Restriction enzyme sites are shown in italics
Table 1: Gene-specific primers used for nested-PCR and RT-PCR.