Gene fragment Primers Sequence(5'-3') Amplicon size (bp) PCR rogram
MT-10.3(1M-40S) BamHI F 5'CGCGGATCCATGTCGCAGATTATGTAC3' 120 94°C,5'
94°C,1'
60°C,1'   25x
72°C,1'
72°C,5'
  SacI R 5'TATGAGCTCGGACAGCACGGCCTGCTC3'  
CE15(173G-187A) SacI F 5'ACGGAGCTCGGGGTGATTTTCTTCTTC3' 42
  SalI R 5'TATGTCGACTGCTTCGGGCAGCAACTC3'  
MT-10.3(41S-96) SalI F 5'ATAGTCGACAGTGCTTGGCAGGGTGAT3' 171
  HindIII R 5'ACAAAGCTTTAGCCGCCCCACTTGGC3'  
MPT-64(91L-205A) SacI F 5'TATGAGCTCCTCAAGGTCTACCAGAAC3' 348
  SalI R 5'TATGTCGACGGCCAGCATCGAGTCGAT3'  
Table 1: Primers and PCR conditions used for cloning different sequences of MT10.3 and MPT-64. Underline: enzyme restriction site; F: forward primer; R: Reverse primer.