alexa A High Sensitive Nested PCR for Toxoplasma gondii Detection in Animal and Food Samples | Open Access Journals
ISSN: 1948-5948
Journal of Microbial & Biochemical Technology
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

A High Sensitive Nested PCR for Toxoplasma gondii Detection in Animal and Food Samples

Maria Vitale1*, Paola Galluzzo1, Vittoria Currò1, Kataryna Gozdzik2, Domenico Schillaci3 and Vincenzo Di Marco Lo Presti1

1Zooprofilactic Experimental Institute of Sicily (IZS Sicily), A. Mirri, via Gino Marinuzzi 3, Palermo 90129, Italy

2Witold Stefanski Institute of Parasitology of the Polish Academy of Sciences, 51/55 Twarda Street-00818, Warsaw, Poland

3Department of Biological, Chemical and Pharmaceutical Science and Technology (STEBICEF), University of Palermo, via Archirafi 32, Palermo 90123, Italy

*Corresponding Author:
Maria Vitale
Zooprofilactic Experimental Institute of Sicily (IZS Sicily)
A. Mirri, via Gino Marinuzzi 3, Palermo 90129, Italy
E-mail: [email protected]

Received date: February 19, 2013; Accepted date: March 14, 2013; Published date: March 18, 2013

Citation: Vitale M, Galluzzo P, Currò V, Gozdzik K, Schillaci D, et al. (2013) A High Sensitive Nested PCR for Toxoplasma gondii Detection in Animal and Food Samples. J Microb Biochem Technol 5:039-041. doi:10.4172/1948-5948.1000097

Copyright: © 2013 Vitale M, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Microbial & Biochemical Technology

Abstract

Toxoplasma gondii is a major food and waterborne transmitted parasite world-wide. The tissues and meat samples of many warm blooded animals can contain tissues cysts from chronic toxoplasmosis. Water and vegetable can be contaminated by the parasitic oocysts shed through the feces of infected cats, representing the definitive host of the parasite.

A sensitive PCR for Toxoplasma gondii detection is described. The first step amplified the region between the 28S and 18S rDNA in the closely related T. gondii and Neospora caninum; RFLP analysis distinguished the DNA from the two morphologically identical parasites. Although N. caninum is not involved in human transmission, so far, it is important for animal health since is a major responsible for abortion in cattle.

The nested PCR was used in a dilution assay in pork sausage samples spiked with T. gondii parasitic DNA. The analysis showed that up to 200fg equivalent to two single parasites only, could be detected. Similar detection limit for T. gondii can be obtained with real-time PCRs, but real time methods need special consumables and expensive equipment.

Keywords

Neospora caninum; Toxoplasma gondii; Restriction fragments length polymorphism; Nested PCR

Introduction

Toxoplasma gondii is a coccidian protozoan that can infect different tissues in several warm blooded animals and toxoplasmosis is the most diffused food and waterborne parasitic infection worldwide [1]. The serological screening for T. gondii reveal high positive level in livestock and the presence of tissue cysts in meat is an important risk factor for toxoplasmosis transmission. The infection is quite often mild or asymptomatic in immune-competent individuals but can be particularly severe in immune-compromised subjects. Furthermore T. gondii is implicated in abortion cases in several animal species. Congenital toxoplasmosis (the vertical transmission from the mother to the fetus) is a big concern in public health for the potential severe outcomes for the baby [2]. The consumption of undercooked or raw meat is a main risk factor for toxoplasma infection in human beings, as established by multicenter study [3]. However, several typical cuisines include dishes based on raw meat preparation in many countries and these traditional practices can be difficult to change despite educational campaigns [4].

In this paper, a nested PCR targeting the ribosomal DNA locus is described. The ribosomal locus in T. gondii is represented by a 7.5- kb rDNA unit arranged in head-to-tail tandem repeats of at least 110 copies per haploid tachyzoite genome [5]. The sensitivity was evaluated using spiked fresh pork sausage.

Materials and Methods

T. gondii DNA was extracted from the reference strain Me49 provided by the European Parasite Reference Laboratory at the National Institute of Health in Rome.

N. caninum DNA was obtained from tachyzoites of Polish bovine isolate NcPolB1 and from a reference strain NC1 maintained at the Witold Stefanski Institute of Parasitology, Warsaw [6].

The analysis on fresh prepared pork sausage was set-up as follows: a sample of 5 g of the sausage was suspended in 5 ml TRIS-EDTA and homogenized by EDTS VIII homogenizer (Design Village Ltd, U.K.). A positive suspension was prepared by adding an aliquot of 10 μl of a DNA solution at concentration of 1 ng/μl to a volume of aliquot of 190 μl of the sausage homogenate. Four serial dilutions of 1 to 10 up to 1 pg of DNA followed by two further dilutions 1 to 5 to a final amount of 0.04 pg were prepared. The DNA was extracted from the homogenates by Gene Elute mammalian kit (cat N° G1N350Sigma-Aldrich St. Louis, MO, USA) following manufacturer’s instructions.

First PCR and RFLP analysis

Common primers for T. gondii and the related parasite N. caninum NC 18S RNA sense primer 5’ TGCGGAAGGATCATTCACACG 3’ and NC28S RNA antisense primers 5’ CCGTTACTAAGGGAATCATAGTT 3’ where used for the first PCR. The digestion with endonucleases Hinf I (Promega Madison, WI, USA) of the first amplification product was performed with DNA extracted from the parasite. After first PCR, an aliquot of 5 μl of the PCR reaction was digested in 50 μl of final volume in 1X enzyme buffer at 37°C for 1 hour. The digested products were loaded on 2% agarose gel containing ethidium bromide and visualized on CHEMI-DOC image-analyser (Biorad, Hercules, CA 94547 USA).

For the nested PCR, 1 μl after the first, was amplified with T. gondii specific primers Toxo ITS1sense 5’ GATTTGCATTCAAGAAGCTGATAGTAT 3’, and ToxoITS1 antisense 5’ AGTTAGGAAGCAATCTGAAAGCACATC 3’ [7].

Both PCR reactions were performed on 50 μl of 50 mM KCl, 1.5 mM MgCl2, 20 mM Tris-66 HCl (pH 8.4), 100 μM (each) dATP, dTTP, dCTP, and dGTP, 50 pmol of primers, and 3U of Taq gold DNA polymerase (Applied Biosystem, Life Technologies Corporation) with the following PCR program: 10 min at 95°C and then 40 cycles of 50s at 94°C, 30s at 60°C, 1 min. at 72°C and a final extension of 7 min at 72°C in a 9700 thermal cycler (Applied Biosystem Life Technologies Corporation).

Results and Discussion

The PCR primers used for the first PCR were chosen in a conserved region of the rRNA locus of the two similar parasites N. caninum and T. gondii. An amplicon of almost 1000 bp is obtained after first amplification spanning the intergenic region included between 18S and 28S of the rRNA locus. The morphologically identical oocysts of N.caninum and T. gondii can be distinguished by Restriction Fragments Length Polymorphism (RFLP) analyses upon digestion with restriction enzymes. After the restriction with Hinf I, a doublet of 500 bp is present in T. gondii and three fragments in N. caninum (Figure 1). A comparison of the same region in gene bank database showed that all T. gondii and N. caninum isolates sequenced so far have the same Hinf I restriction map respectively and different RFLP can be also observed using other frequent cutter enzymes like RsaI and AluI.

microbial-biochemical-technology-toxoplasma

Figure 1: First PCR amplicon of 1000 bp was digested with Hinf I for 1 hour at 37°C and run on 1.5% agarose gel.
RFLP pattern on first PCR-amplicons from Toxoplasma gondii and Neospora caninum isolates after digestion with Hinf I.
Lane 1: undigested 1 kb amplicon of T. gondii.
Lane 2: T. gondii me 49, first PCR amplicon digested: the pattern shows a doublet of 500 pb which is indicative of one recognition site for Hinf I.
Lanes 3: digestion pattern in the amplicon of N. caninum PolB1 isolate [6].
Lane 4: digestion pattern in the amplicon of NC1 reference strain [6].
Both DNAs show DNA fragments of 500 bp, 300 bp and 200 bp, revealing the presence of two recognition sites
Lane 5: DNA size marker 100 bp ladder.

The two parasites are so closely related and morphological identical that N. caninum was misdiagnosed as T. gondii until 1988 when its identity and life cycle were discovered [8]. N. caninum has a narrower host spectrum and it is not implicated in zoonosis but is important in animal health because it is a major cause of abortion in cattle [9]. Toxoplasmosis on the contrary is the most diffused parasitic zoonosis in the world. Nested PCR, increasing both specificity and sensitivity of the analysis, can be used to screen animal tissues and meat samples such as milk, meat, vegetables, for the presence of the parasitic DNA. The described nested PCR was set on spiked pork sausage because several human acute toxoplasmosis cases in Italy are suspected to be related to this meat preparation. As established by a questionnaire administration, the very common practice to taste raw fresh sausage might be responsible of many cases of acute toxoplasmosis. To evaluate the sensitivity of the method, pork sausage homogenates was spiked with T. gondii DNA and a series of dilutions of 1:10 were performed starting from 1000 pg to 1 pg (lane 1 to 4 of figure 2) followed by two dilutions 1:5 up to 40 fg of DNA (lanes 5 and 6). The DNA could be detected in the nested step up to 200fg (lane 5) and no amplification with N. caninum DNA was observed (lane 8). The detected amount is equivalent to two parasites with a comparable sensitivity shown in the real-time PCR assay described by Jauregui et al. [7]. Many end-point and real time PCRs have been evaluated for Toxoplasmosis diagnosis so far, but still a unique standardized method is not available [10,11]. Direct comparisons among different methods have shown that the performance of the results depend upon a lot of variables such as the copies number of the DNA template and the type of clinical specimen (blood versus CSF or amniotic liquid) [12,13]. It has also been reported a nested PCR method that had a higher sensitivity compared to two real-time PCRs which allowed a more rapid identification of T. gondii DNA but showed some discrepancies in a minority of routine samples from immune-compromised patients [14]. A commercial nested PCR, approved for T. gondii analysis in human clinical specimens, has been evaluated for analytical performance and economic impact in with two different real-time methods. The analytical performance showed that one real-time method was more sensitive whereas the other real time and nested PCR had the same sensitivity. In terms of economic impact, the commercial nested PCR used by the authors, resulted more expansive in consumables compared to the two real-time PCRs; however nested PCR was still recommended for small laboratories that process few clinical samples per year because of the high cost of the real time equipment [13]. Several nested PCRs for other infectious diseases are often reported to have similar analytical performance to real time PCRs that require higher cost for equipment and consumables [15,16]. The described in house nested PCR in our hands is cheaper in consumables and has the advantages to permit: i) the distinction between N. caninum and T. gondiioocysts which is important in veterinary medicine and ii) the screening of food samples by a high sensitive method with no need for expensive equipment. Although the nested PCR is more time and work consuming with a higher possibility of sample contamination, it is easily performed in many laboratories in the veterinary field and in developing countries where budget constraints are important.

microbial-biochemical-technology-femtograms

Figure 2: Nested PCR assay with fresh pork sausage samples spiked with T. gondii DNA at different concentrations expressed in picograms (pg) and femtograms (fg). T gondii specific primers amplify a region of 313 bp in the intergenic region 1 (ITS1) of the parasite ribosomal RNA operon [7] internal to the first amplicon.
Lane 1-1000 pg
Lane 2-100 pg
Lane 3-10 pg
Lane 4-1 pg
Lane 5-200 fg
Lane 6-40 fg
Lane 7-empty
Lane 8-PCR with Neospora DNA (NC1)
K-: PCR mix with no template
K+: PCR mix plus T. gondii DNA from strain Me49.
The DNA could be detected up to 200 fg corresponding to two parasites (lane 5).
The amplicon of 313 bp is pointed by the arrow.

Acknowledgements

The authors thank Dr. Maria Anna La Giglia for her scientific contribution. The study was funded by Italian Ministry of Health: grant N° RF-2007 and RC 2009 to Vitale M.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 11793
  • [From(publication date):
    March-2013 - Aug 24, 2017]
  • Breakdown by view type
  • HTML page views : 7975
  • PDF downloads :3818
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords