Primers number Primer sequences(5’-3’) protein names and position in gel Length of PCR products (bp) PCR conditions (°C/s) PCR results of four strains of Brucella Denaturation Annealing Elongation M5 16M 544A S19 1 catatgatgggaattgccccggcttac ctcgagtcaaaggtcgccggcgtcttc maltose binding protein (point 1) 1272 94/30 60/30 72/60 + + + + 2 catatgatgaacttcggtcttggcgag ctcgagtcaacgggtctcctgaaagag isovalery-CoA dehydrogenase (point 3) 1149 94/30 58/30 72/60 + + + + 3 catatgatgaagctcaaggctcttc ctcgagtcagaacttgtaagcgacac 25kDa-outer membrane immunogenic protein precursor (point 5) 687 94/30 55/30 72/60 + + + + 4 catatggtggttgtttctgaaccttccg ctcgagttagaacttgtagttcagaccgacg 31kDa-outer membrane immunogenic protein precursor (point 6) 660 94/30 58/30 72/60 + + - - 5 gagctcatggcctcattgttcgaccccattac ctcgag tcatgccagaacgggataatc glycerol trinitrate reductase (point7) 1116 94/30 58/30 72/60 + + + + 6 gagctc atgcaattttgccttcag ctcgagttaatacctgtagtgttccgacttg succinyl-CoA synthetase subunitalpha (point 8) 903 94/30 58/30 72/60 + + + + 7 catatggtgcaaatcaacaggagaggc ctcgagtcagatgtcggcggcgatac peptidyl-prolyl cis-trans isomeraseA (point 10) 531 94/30 57/30 72/60 + + + + 8 catatgatgtccattctcgtcaacaag ctcgagtcagcccttgaggacttcaac S-adenosyl-L- homocysteine hydrolase (point 9) 1446 94/30 58/30 72/60 + + + + 9 catatgatggcaaagagtaagtttgaacgtac ctcgag ttactcgatgatcgacgagacg Protein translation elongation factor EF-TU (point 2) 1176 94/30 58/30 72/60 + + + + The primers for the genes of the identified proteins were designed and amplificated by PCR in four Brucella strains. The optimized PCR conditions and the length of PCR products were determined. The results of the PCR amplification in four different Brucella strains were shown.” +”, Corresponding sequence have been able to amplify; “-”, Corresponding sequence not been able to amplify

Table 2: Primers for genes of the identified proteins and PCR results.