SNP name Rs
Number
Primers Restriction enzymes Digested product length
IL4C–590T 2243250 Forward
5’>ACTAGGCCTCACCTGATACG<3’
Reverse
5’>GTTGTAATGCAGTCCTCCTG<3’
BsmFI TT: 254 bp
CC: 210 bp, 44 bp
CT: 254 bp, 210 bp, 44 bp
IL-4RA175V 1805010 Forward
5’>GGCAGGTGTGAGGAGCATCC<3’
Reverse
5’>GCCTCCGTTGTTCTCAGGTA<3’
Rsal AA: 273 bp
GG: 254 bp, 19 bp
AG: 273 bp, 254 bp, 19 bp
Table 1: Overview of the SNP [18].