No SNP Name Forward primer Reverse Primer Alleles registered in NCBI
1 -1722C>T 5’CAAGCTTTGTCCTGTGACCA3’ 5’AAGCGCCAACAAGCATAAC3’ FJ013949
FJ013950
2 -1661A>G 5’GCCACTGCTGTGTGTTCCT3’ 5’ATGTGCCTGTTGGTGTGAT3’ FJ013951
FJ013952
3 -651C>T 5’TCCTTCTGCAAAACCAGAGGCAGCT3’ 5’AGTACAAGGGTCCTCCTAAATCCCA3’ GQ370246
GQ370247
4 -318C/T 5’-AAGGATGCCCAGAAGATTGA3’ 5’AGCCGTGGGTTTAGCTGTTA3’ Q390244
Q390245
5 +49A>G 5'-AAGGCTCAGCTGAACCTGGT-3' 5'CTGCTGAAACAAATGAAACCC3' DQ534199 DQ534200
6 -819C>T 5’GGAGAGGGGCCTGGTTAGTTACA3’ 5’AGAGAGGCAGCGGTG GTGTCA3’ EU103999
EU104000
7 CT60 (+6230G>A) 5’-CACCACTATTTGGGATATACC-3’ 5’AGGTCTATATTTCAGGAAGGC3’ GQ370006
GQ370007
Table 2: The primers used in PCR-RFLP technique for genotyping the SNPs of CTLA-4 in this study.