Name Forward and reverse PCR primers (5’-3’) PCR product/primer features
R4F R5R TTAAGAGCTCATGAGAGTAGCAAACGTAAG TTAAACTAGTCCGGGTAACCCAGTTCC 5’ ribosomal flanking sequence
R6F R7R TTAACTCGAGGCACCTGTCACTTTGG ATTAGGTACCATCAGGTTCCACCAAACAG 3’ ribosomal flanking sequence
NEOF NEOR AATTACTAGTATTTATGCAGAGGCCGAGG TTATCTGCAGTCAGAAGAACTCGTCAAGAAG Neomycin resistance gene and promoter
CYC1F CYC1R TTAACTCGAGATCCGCTCTAACCGAAAAGG ATTTCTCGAGCTTCGAGCGTCCCAAAACC TcycI transcriptional terminator
GAPDHF GAPDHR TTAACTGCAGCGAGTTTATCATTATCAATACTCG TTAAAAGCTTCGAAACTAAGTTCTTGGTG GAPDH promoter
S308L-OPHF S308L-OPHR CCAGAGTTTTTCGGAAGCAG TCGGCTAACAGGGAAACATC S308L-OPH qPCR real time primers
YLR346CF YLR346CR GGCTGTGCCTTTTCACTTTC GGTAATGCGAATGAGCAGGT Internal qPCR real time control
OPHF OPHR GAAGGCTTGTCGCCAAGTAG GAGCCCTAGTCTGCCAACTG Internal OPH verification primers
S308L.INTF S308L.INTR CAATCCCGCACGTTTCTTAT AATGAGCCATTCGCAGTTTC Spanning 3’ S308L integration site
OPD.INTF OPD.INTR GGAGGATAATGCATCGGCTA TCCGTCACCATACCATAGCA Spanning 3’ OPH integration site
Bold represents restriction endonuclease site sequences: GAGCTC, SacI; ACTAGT, SpeI; CTCGAG, XhoI; GGTACC, KpnI; CTGCAG, PstI; AAGCTT, HindIII.
Table 3: PCR primers used in this research.