Strain designation 5’→3’ primerĀ  sequences1 Reference
Acinetobactercalcoaceticus 3462 TAC GCA GGG TAA TGA ATC AA Chang et al., 2005
TCC GTG TCT CAG TAC CAG TG
Alcaligenesfaecalis subsp. faecalis ATCC 87503 CAT CCC GCG GTG TAT GAT GAA Phung et al., 2012
TCT GAC ATA CTC TAG CTC GG
Arthrobacterglobiformis 6072 GTC GCG TCT GCT GTG AAA GC Crocker et al., 2000
TTT AGC CTT GCG GCC GTA CT
Bacillus cereus ATCC145793 AGA GTT TGA TCC TGG CTC AG Bavykin et al., 2004
TAC GGC TAC CTT GTT ACG ACT T
Flavobacteriumcapsulatum 3152 TAC TCG CAG AAT AAG CAC CG GenBank Accession M59296
GTA TCT AAG TTC CCG AAG GC
Pseudomonas fluorescens13525 GGTCTGAGAGGATGATCAGT Widmer et al., 1998
TTAGCTCCACCTCGCGGC
1Top sequence given for each species = forward primer; bottom sequence = reverse
2Reference strain obtained from Presque Isle Cultures, Erie, PA
3Reference strain obtained from American Type Culture Collection, Manassas, VA
Table 3: ATCC reference strains and PCR primers used in the rDNA-based quantification aspect of this study.