Probe# Sequence, 5’→3’ Tm/ΔTm, °CTarget
DNA RNA
DNAref d(TGCACTCTATGTCTGTATCAT) 59.0 60.5
P1 d(TGCAC(1)CTATGTCTGTA(1)CAT) 63.0/+4.0 68.0/+7.5
P2 d(TGCAC(1)CTATG(1)CTGTA(1)CAT) 65.0/+6.0 71.0/+10.5
P3 d(TGCAC(6)CTATGTCTGTA(6)CAT) 58.0/-1.0 64.0/+3.5
P4 d(TGCAC(6)CTATG(6)CTGTA(6)CAT) 58.0/-1.0 66.0/+5.5
P5 d(TGCAC(7)CTATGTCTGTA(7)CAT) 63.0/+4.0 65.0/+4.5
P6 d(TGCAC(7)CTATG(7)CTGTA(7)CAT) 65.0/+6.0 66.5/+6.0
P7 d(TGCAC(9)CTATGTCTGTA(9)CAT) 67.0/+8.0 67.0/+6.5
P8 d(TGCAC(9)CTATG(9)CTGTA(9)CAT) 72.0/+13.0 70.0/+9.5
Table 1: Representative sequences of LNA/DNA probes and thermal denaturation temperatures of the duplexes applied in homogeneous sensing of anti-dsDNAs[10].