Patients aCGH result Primers used for real-time PCR
Case 1 Del Xq25 Forward: CCTATTGTGATGCTCCATCAGAAAC Reverse: CAGCTTGTTGAGAGTGACATGCTA
Forward: TGAGCTCAAATGGTGCTCTCA
Reverse: AGGAAGCTGGCCTTCAATCTC
Case 2 Dup 16p13.11 Forward: CGGTCAAGGTCATGAATCCAT
Reverse: CCCACAACACTCCCCTTAACC
Forward: CATGGTGCTGGTACCCAGAA
Reverse: GATGGCAAAGAAGCCTTGATG
Del 16p11.2 Forward: CCAGTGCTGCGTCCTTATCA
Reverse: CCCACCAAGTCTCACCCTCTT
Forward: GCAGCAGGGCATGAAGTAGAA
Reverse: AGGTTATGCCCGGATTGTCTT
Case 3 Del 6p22.1 Forward: CCAGTCAACCCGGAGATCA
Reverse: TCCTACAAAGCAATGGAACTTTACC
Forward: TCAAACTGTTCCTTGGCACTTCT
Reverse: GGGTGGATAGGGTTTCTGGAAT
Dup 14q32.33 Forward: TCCCCCAACCTCACTCTCAA
Reverse: CCGGCCTCCCTTGTTCTT
Forward: GCTTAGGGACAGGACAGACCAT
Reverse: CCCAGCAAAGGCTCAGGAA
Case 4 Del 7q31.1 Forward: AGCAATGCGGAATGATGTAGAAAT Reverse: AAGTATGAGGTGTAGGCTGTCACG
Forward: TATTTTATCACCCACCACTACCACA Reverse: AAAAGCCAAGAAGGGTATAGAGATTTC
Table 1: Primers used in real-time PCR confirmation of aCGH findings.