Gene Direction Sequence (5’->3’) Fragment
Length
Gene Bank Number
CD54 F ggctggagctgtttgagaac 249 NM_000201
  R tcacactgactgaggccttg    
CD49d F gttttccagagccaaatcca 185 NM_000885
  R gccagccttccacataacat    
CD73 F CGC AAC AAT GGC ACA ATT AC 241 NM_002526
  R CTC GAC ACT TGG TGC AAA GA    
CD81 F tcatcctgtttgcctgtgag 270 NM_003756
  R cctccttgaagaggttgctg    
CD90 F cacacataccgctcccgaacc 190 NM_006288
  R gctgatgccctcacacttgacc    
CD105 F TGC CAC TGG ACA CAG GAT AA 205 NM_000188
  R CCT TCG AGA CCT GGC TAG TG    
CD109 F gtctccttcccacatcctca 192 NM_133493
  R cagcttctttcccaaactgc    
CD146 F accctgaatgtcctcgtgac 202 NM_006500
  R tctctgtggaggtgctgttg    
CD164 F aagtggggaacacgacagac 159 NM_001142401
  R tgaaactggctgcatcaaag    
CD172a F tggtagtgcagccttctgtg 101 NM_080792
  R ggcattgggtctcgataaga    
Table 1: The sequences of primers used in study.