Gene Direction Sequence (5’->3’) Fragment
Length
Gene Bank
Number
 
CD54 F ggctggagctgtttgagaac 249 NM_000201  
  R tcacactgactgaggccttg      
CD49d F gttttccagagccaaatcca 185 NM_000885  
  R gccagccttccacataacat      
CD73 F CGC AAC AAT GGC ACA ATT AC 241 NM002526  
  R CTC GAC ACT TGG TGC AAA GA      
CD81 F tcatcctgtttgcctgtgag 270 NM_003756  
  R cctccttgaagaggttgctg      
CD90 F cacacataccgctcccgaacc 190 NM_006288  
  R gctgatgccctcacacttgacc      
CD105 F TGC CAC TGG ACA CAG GAT AA 205 NM000188  
  R CCT TCG AGA CCT GGC TAG TG      
CD109 F gtctccttcccacatcctca 192 NM_133493  
  R cagcttctttcccaaactgc      
CD146 F accctgaatgtcctcgtgac 202 NM_006500  
  R tctctgtggaggtgctgttg      
CD164 F aagtggggaacacgacagac 159 NM_001142401  
  R tgaaactggctgcatcaaag      
CD172a F tggtagtgcagccttctgtg 101 NM-080792  
  R ggcattgggtctcgataaga    
Table 1: The sequences of primers used in study.