Pair Gene Primer Orientation Primer sequence (5'-3') Distance*
A S2 RPS2exCF forward CCHGTNCCCAAGAAGCTGCT 70
  S2 RPS2exDR reverse GGTYTCCTTCCASAGRTCAG 43
B S3 RPS3ex1F forward AAATCTCVAAGAAGAGRAAG 2
  S3 RPS3ex2R reverse ACRCCGGAGTANCCATCCTC 62
C S3 RPS3ex2F forward GAGGATGGNTACTCCGGYGT 53
  S3 RPS3ex3R reverse CKCTTCTGVACMACAGCGGT 48
D S3 RPS3ex3F forward ACCGCTGTKGTBCAGAAGMG 30
  S3 RPS3ex4R reverse GTCGCAACCTTCTCAGCRTA 24
E S3 RPS3ex4F forward TAYGCTGAGAAGGTTGCGAC 74
  S3 RPS3ex5R reverse AASCKCAGRACACCATARCA 6
F S14 RPS14exAF forward GCCTCMTTYAACGAYACCTT 29
  S14 RPS14exBR reverse CKGTCRGCCTTYACCTTCAT 30
G S17 RPS17exBF forward AGWGGMATCTCCATCAARCT 49
  S17 RPS17exCR reverse GGRTCRACCTCGATGATSTC 18
H S23 RPS23exAF forward TCACACGCCAARGGCATYGT 15
  S23 RPS23exBR reverse ATRGCAGAGTTRGGCTGCTT 14
I S23 RPS23exBF forward AAGAACGGCAARAAGATCAC 42
  S23 RPS23exCR reverse TGACCYTTACGWCCRAATCC 26
J S27 RPS27exAF forward GCTAARATYCARGAYAAGGA 4
  S27 RPS27exBR reverse GTGCGKCCRTCYTCCAGCTG 43
K L3 RPL3exAF forward GGCTACAAGGCYGGYATGAC 39
  L3 RPL3exBR reverse CAGTTYTTGTAGAAKCGACG 149
L L3 RPL3exBF forward GCGTCGMTTCTACAARAACT 2
  L3 RPL3exCR reverse GTGAARGCCTTCTTCTYGGA 9
M L3 RPL3exDF forward CAAGGGWCACGGRTDCAAGG 2
  L3 RPL3exER reverse GTCTTRCGGGGMAGCTTCTT 25
N L8 RPL8exBF forward AGTTCATCTACTGCGGCAAG 37
  L8 RPL8exCR reverse ATGAYGGTDCCYTCAGGCAT 5
O L9 RPL9exCF forward RAACTTCYTGGGRGAGAAGT 110
  L9 RPL9exDR reverse ACDGTGGTGGCYTGCTGGAT 10
P L11 RPL11exAF forward CARACGCCHGTCTTCTCCAA 5
  L11 RPL11exBR reverse AAGGATCKYACAGTGTAGCG 4
Q L11 RPL11exBF forward CGCTACACTGTRMGATCCTT 87
  L11 RPL11exCR reverse CCCARRTCGATGTGYTCCTG 65
R L17 RPL17exAF forward GAGWCMGCTCAGGCCATCAA 132
  L17 RPL17exBR reverse TCGGCRCTCTTCTTRGGCCA 8
S L24 RPL24exBF forward AGMCGCAARCACAAGAAGGG 13
  L24 RPL24exCR reverse ACYTCAGGCTTCTGRTTCCT 85
*Number of nucleotides between 3’-end of the primers and start or end of the target introns
Table 1: Sequences of primers for amplifying 19 introns of 12 ribosomal protein genes.