Gene name Primer sequence PCR size (bp) Accession number
(5’→3’)
Estrogen receptor a (ERa) F:CCGGCCCTACACAGAGATCA 150 bp NM_152959
R:AGCCAAGAGCTCTCCAACAACT
Estrogen receptor b1 (ERb1) F: CTGTGCCGTCTGCAGTGATT 150 bp AF516874
R: CGGCGGTTCTTGTCGATAGT
Estrogen receptor b2 (ERb2) F: TCCGACACCTCAGCAACAAA 150 bp AF349413
R: TTTCTGGGCTCTGTTGTCTGTCT
NK2 homeobox 5 (Nkx2.5) F: CGGGATGGTAAACCGTGTCT 150 bp NM_131421
R: GCTCGACGGATAGTTGCATGA
NK2 homeobox 7 (Nkx2.7) F: AGCTCACATCCACACAGGTCAA 150 bp NM_131419
R: GAGCTCCGTGACAGGGTTTG
Heart and neural crest derivatives expressed 2 (Hand2) F: TGTCATGAAGAACCCCCCTAT 150 bp NM_131626
R: CCCCGGTACTCCTCCGTAGT
GATA-binding protein 4 F: CCAGTCTGCAACGCATGTG 150 bp NM_131236
(GATA-4) R: GATCGCCGACTGACCTTCAG
GATA-binding protein 5 F: GGGACGCCAGGGAACTCTA 150 bp NM_131235
(GATA-5) R: CACGCGTTGCACAGGTAGTG
GATA-binding protein 6 F:AGTCGCGACCAGTACCTTTCAA 150 bp NM_131557
(GATA-6) R: CCTTCGGGATTGCAGTGAGT
Fibroblast growth factor 1a F: ATGGCAAGCTGTACGCTTCA 150 bp NM_200760
(FGF1a) R: GGCCCCGTTTCATTTTCC
T-box 2a (Tbx2a) F:ACGTTTTCCCTGAGACCGATT 150 bp AF179405
R:ATGGAAGGGTCAGCTGTTTCC
T-box 2b (Tbx2b) F: ACGTTTTCCCTGAGACCGATT 150 bp NM_131051
R:ATGGAAGGGTCAGCTGTTTCC
T-box 5a (Tbx5a) F: CGGATGTTTCCCAGCTTCAA 150 bp NM_130915
R: CATCGCAGGCTCAGCTTTC
Elongation factor 1a (ef-1a) F: TGGTGGTGTCGGTGAGTTTG 150 bp AY422992
R: AAACGAGCCTGGCTGTAAGG
Table 1: Primer sequences and gene names.