Gene (Exon) Forward primers (5’→3’) Reverse primers (5’→3’)
DNM2 (1) TCTCCCAGCCTGAAACCC TGCCACTCACCTCCTCATC
DNM2 (2) CAGCGACCAGCATTGAGA CCCTGGCATTTGCTATTT
DNM2 (3) AGGTGAAGCCTGGGTTGG CCGTGAGGGAACTTTCTGG
DNM2 (Intron) CCCGCAGAAACGTCTACAA CCACCTCAGCCTCCCAAA
DNM2 (4) TTCCAATGCCCAGGTGAG CTACCGTGCCCGGCTAAT
DNM2 (5) GTTCTGGGTTGGGGTGAT GGCGGGGTATTTATTCACA
DNM2 (6) GCAAGGGAAGGTGGGACTG AGGGCTCCGCTACTCTGTG
DNM2 (7) GGGCTCACTGAGGGTCAAA GGATGGTGTCAAGGGTTCTGG
DNM2 (7b) GGGGTGTTGCACTTTGGG ATGGCCGGGAAGGACTAT
Table1: PCR primers for DNM2 sequence analysis.