Priner Name Sequence( 5’-3’) Mer TM % GC
ITS-Primers pairs        
T/ITS 1 TCTGTAGGTGAACCTGCGG 19 63.9 57
T/ITS4 TCCTCCGCTTATTGATATGC 20 61.5 45
ISSR primers        
A-1 5’YC (TG)7T3’ 17 49.77 47
A -2 5’(GA)9AC3’ 20 53.70 55
A-3 5’(GA)9T3’ 20 58.01 47
A-4 5’(GA)8AC3’ 18 56.35 40
A-5 5’(AG)8AC3’ 18 60.17 50
A-6 5’(AG)8AT3’ 18 60.26 47
Table 1: The nucleotide sequence used for ITS and Trichoderma PCR.