Primer Name Tm (°C) Primer Sequence
Limiting primer exon 18 75 5’ CCCAGAGGCCTGTGCCAGGGACCTTAC 3’
Excess primer exon 18 72 5’ CTTGTCTCTGTGTTCTTGTCCCCCC 3’
Limiting primer exon 19 75 5’ CCATGGACCCCCACACAGCAAAGCAGAAACTCAC 3’
Excess primer exon 19 72 5’ GCCAGTTAACGTCTTCCTTCTCTCTCTGTCATA 3’
Limiting primer exon 20 74 5’ TGGGAGCCAATATTGTCTTTGTGTTCCCGGACATAGT 3’
Excess primer exon 20 72 5’ GTGCCTCTCCCTCCCTCCAG 3’
Limiting primer exon 21 75 5’ AGGAAAATGCTGGCTGACCTAAAGCCACCTCCTTAC 3’
Excess primer exon 21 72 5’ CTCACAGCAGGGTCTTCTCTGTTTCAG 3’
Table 1: Assay primer sequences.