Probe Tm (°C) Probe Sequence 5' Mod. 3’ Mod.
Exon18 ON 71 5’GGTTGATCTTTTTGAATTCAGTTTCCTTCAAGATCCTCCC 3’ FAM BHQ-1
Exon18 OFF 65 5’ CGGAGCCCAGCACT 3’ BHQ-1 BHQ-1
Exon18 ON 69 5’ CAAAGAGAGCTTGGTTGGGAGCTTTG 3’ BHQ-1 FAM
Exon18 ON 59 5’ GGCTCCACTGGGTGTAAGCC 3’ BHQ-1 FAM
Exon18 OFF 61 5’ AGGCTCCACAAGCTG 3’ BHQ-1 C3
Exon19 ON 69 5’ GGACCTTCTGGGATCCAGAGTCCCCC 3’ Cal-Red BHQ-2
Exon19 OFF 62 5’ ACGGGAATTTTAACTTTCTC 3’ - BHQ-2
Exon19  ON 59 5’ CCGCTTTCGGAGATGTTGCTTGG 3’ BHQ-2 Cal-Red
Exon19 OFF 57 5’ CTCTTAATTTCTTGATAGCG 3’ BHQ-2 BHQ-2
Exon19 ON 62 5’ TTATCGAGGATTTCCTTGTTGGAA 3’ BHQ-2 Cal-Red
Exon20 ON 59 5’ GCAGATACCCAGTAGGCGG 3’ Quasar BHQ-2
Exon20 OFF 55 5’ CTGCATGGTGAAGGTGAG 3’ BHQ-2 BHQ-2
Exon20 OFF 64 5’ GCATGAGCCGCGTGATGAG 3’ BHQ-2 BHQ-2
Exon20 ON 69 5’ CCAGGGGGCAGCCGAAGG 3’ BHQ-2 Quasar
Exon21 OFF 50 5’ CCAGCATTATGGCTCGCCC 3’ BHQ 1 C3
Exon21 ON 70 5’TTAAAATCTGTGATCTTGGCATGCTGCGGTGAA 3’ Cal-Or. BHQ-1
Exon21 ON 56 5’ TTTTTGTCTCCCCCTGCATGGTATTCTTAA 3’ BHQ-1 Cal-Or.
Exon21 OFF 44 5’ TCTCTTCTGTACCC 3’ BHQ-1 C3
Exon21 ON 59 5’ CCACGGTCCCCCAAGTAGTTTATGCCGG 3’ Cal-Or. BHQ-1
Exon21 OFF 42 5’ CTAGGTCTTGGTGGATTGAGCG 3’ BHQ-1 BHQ-1
Exon21 ON 55 5’ CCCACCAGTATGTTCCTGGTTGGG 3’ BHQ-1 Cal-Or.
Abbreviations: BHQ-1, Black Hole Quencher 1; BHQ-2, Black Hole Quencher 2; C3, C3 spacer linker; Cal-Red, Cal-Red 510; Quasar, Quasar 610; Cal-Or., Cal Orange 560
Table 2: Light-On/Lights-Off probe sequences.