Gene TaqMan probe No. forward primer 5’ → 3’ Reverse primer 5’ → 3’
CGB* #71 (Cat. No. 04688945001) TACTGCCCCACCATGACC CACGGCGTAGGAGACCAC
GNRH1 #29 (Cat. No. 04687612001) GACCTGAAAGGAGCTCTGGA CTTCTGGCCCAATGGATTTA
MET #67 (Cat. No. 04688660001) CGTCAACAAAAACAATGTGAGAT AAACTCTGTTCGATATTCATCACG
KRT19 #71 (Cat. No. 04688945001) GCCACTACTACACGACCATCC CAAACTTGGTTCGGAAGTCAT
HPRT Human HPRT Gene Assay, Cat. No. 05 046 157 001 (Roche Diagnostics)
*The nucleotide sequences of primers were designed to enable amplification of all genes encoding beta subunit of human chorionic gonadotropin (CGB1-9)
Table 1: Primers and TaqMan hydrolysis probes used in real time qPCR.