Name Forward primer Reverse primer
Unmethylated (U) TTATTAGAGGGTGGGGTGGATTGT CAACCCCAAACCACAACCATAA
Methylated(M) TTATTAGAGGGTGGGGCGGATCGC GACCCCGAACCGCGACCGTAA
Table 3: Sequence of oligonucleotides used for methylated and unmethylated DNA.