Gene Exon Primer sequence Tm (C) Product size (bp)
EGFR 18 F-5´CCAAATGAGCTGGCAAGTG 3' R-5´TCCCAAACACTCAGTGAAACAAA 3' 58 397
19 F-5´CCCAGTGTCCCTCACCTTC 3' R-5´GCAGGGTCTAGAGCAGAGCA 3' 62 306
20 F-5´CATTCATGCGTCTTCACCTG 3' R- 5´CATATCCCCATGGCAAACTC 3' 58 377
21 F-5´GCTCAGAGCCTGGCATGAA 3' R-5´CATCCTCCCCTGCATGTGT 3' 62 348
PTEN 5 F-5′GCAACATTTCTAAAGTTACCTACTTG 3' R-5′CCAATAAATTCTCAGATCCAGG 3' 50 378
  7 F-5′TGGTATGTATTTAACCATGC 3' R-5′ CCTTATTTTGATATTTCTCCC 3' 57 231
  8/1 F-5′TGCAAATGTTTAACATAGGTGA 3' R-5′CCTTGTCATTATCTGCACGC 3' 55 246
  8/2 F-5 GGAAGTCTATGTGATCAAGA 3' R-5′ CGTAAACACTGCTTCGAAATA 3' 53 286
Table 1: Primer sequences and annealing temperatures for sequencing of EGFR and PTEN genes.