Gene Forward Primer Reverse Primer
NQ1 5'-TTA CTA TGG GAT GGG GTC CA 5'-AAA MC CAC CAG TGC CAG TC
GPX 5'-CTT ACA GTG CTT GTG CGG GG 5'-GTT CTT GGC GTT CTC CTG AT
GSR 5'-GCA TCT ATG CAG TTG GGG AT 5'-GTA GGG TGA ATG GCG ACT GT
Catalase 5'-CGT GCT GAA TGA GGA ACA GA 5'-TCT TCA TCC AGT GAT GAG CG
GADD45 5'-AAA GGA TGG ATA AGG TGG GG 5'-TCC CGG CM MA CM ATA AG
PRDX3 5'-TCT GGT TCC AGT CAA GCA AA 5'-CGT AGT CTC GGG AM TCT GC
BRCA1 5'-TTGCGGGAGGAAAATGGGTAGTTA 5'-TGTGCCAAGGGTGAATGATGAAAG
H2AFX 5'-TTGCCCCGCAGTCTGAAGCG 5'-CCGGCMGAAGGCCACCCAGG
P16 5'-GTGTGGCACATCCCGCCCTC 5'- CGCAAGCTGGCTGGCTCACT
HPRT 5'-GCGTCGTGATTAGCGATGATGAAC 5'- R CCTCCCATCTCCTTCATGACATCT
Table 2: Primers sequence used in RT PCR.