Location on the mtDNA
Primer Sequence Paired combination of primers
used in this study
   
  TY-J-1460 TACAATTTATCGCCTAAACTTCAGCC 2, 4
  C1-N-1687 CAATTTCCAAATCCTCCAATTAT 1
  C1-J-1751 GGATCACCTGATATAGCATTCCC 6, 8
  C1-N-1840 AGGAGGATAAACAGTTCAC/TCC 1
  C1-J-2183 CAACATTTATTTTGATTTTTTGG 11
  C1-N-2191 CCCGGTAAAATTAAAATATAAACTTC 3
  C1-J-2319 TAGCTATTGGAC/TTATTAGG 10, 13
  C1-N-2293 AGTAAACCAATTGCTAGTATAGC 3
  C1-J-2495 CAGCTACTTTATGAGCTTTAGG 13, 14
  C1-N-2514 AACTCCAGTTAATCCTCCTAC 7
  C1-N-2659 GCTAATCCAGTGAATAATGG 5
  C1-J-2792 ATACCTCGACGTTATTCAGA 16
  C1-N-2800 CATTTCAAGT/CTGTGTAAGCATC 7, 9
  TL2-N-3014 TCCAATGCACTAATCTGCCATATTA 9
  C2-J-3138 AGAGCCTCTCCTTTAATAGAACA 18
  C2-N-3389 TCATAAGTTCA[R]TATCATTG 12
  C2-J-3408 CAATGATAT/CTGAAGT/ATATGA 18
  TK-N-3775 GAGACCATTACTTGCTTTCAGTCATCT 15, 17
Table 1: PCR primers* used in this study.* Primers were taken from Wells et al. [10]. N-forward primer; J-reverse primer.