Marker Primer sequence (5’-3’)
DXS6807 F: 5’AAAATACTCCCACCCCCAGT 3’
R:5’TGCATGCATGTTCACATAACTT 3’
DXS981 F: 5’ CGATGAAAGAGTTGGAGATTGTG 3’
R: 5’ CACCATATTGTTCCTTGAGTCCT 3’
DXS6803 F:5’TGTGCTTTGACAGGAAAAACAA 3’
R: 5’ TTCACTTGCTATGTGAAAGAAGC 3’
DXS6809 F: 5’ TGCTTTAGGCTGATGTGAGG 3’
R: 5’ CAGGAATACTGAGGGCATGA 3’
XHPRT F: 5’ AGAGGGCAGTAGCTTTCAGCTT 3’
R: 5’ TGCCACAGATAATACACATCCCC 3’
DXS7423 F: 5’ TGCGAGCCCACTCTTTCTAT 3’
R: 5’ TGGCCTTTGTCTCCAGTACC 3’
DXS1187 F: 5’ AGGCACCTTTCAGCTACTCA 3’
R: 5’ AGAGGGTGATATGGGGGACT 3’
DXYS267 F: 5’ GTGGTCTTCTACTTGTGTCAATAC 3’
R:5’ GTGTGTGGAAGTGAAGGATAG 3’
DXYS218 F: 5’ CTTCTCCCAAGCTGGGTTCT 3’
R: 5’ CAACTGAGGGGACCTGGAAT 3’
DYS448 F: 5’ TGTCAAAGAGCTTCAATGGAGA 3’
R: 5’ TCTTCCTTAACGTGAATTTCCTC 3’
Table 1: Forward and reverse primers used in STRs sequencing.