Primer

Primer sequences   5’-3’

Target

Reference

16S F1
16S R2
GAGTTTGATCCTGGCTCAG GWATTACCGCGGCKGCTG 16S rRNA gene Dorsch and Stackebrandt 1992
H279
H280
GAIIIIGCIGGIGAYGGIACIACIAC YKIYKITCICCRAAICCIGGIGCYTT cpn60 Goh et al. 2000
U341
U803
aGC clamp-CCTACGGGAGGCAGCAG CTACCAGGGTATCTAATCC 16S rRNA gene Muyzer et al, 2003 Baker et al, 2003 Van de Peer et al, 1996
Ef-F
Ef-R
GAGGCAGACCAGATTGACG ACTAGGTGTGGAACGGATG E. faecium specific DNA Cheng et al. 1997
Bl-f
Bl-R
CGTTGCTTCTGATTGCTGAAGACG CGTTGAATGTTCCGCGAAGCTTGT Bacillus licheniformis cpn60 This study
Bc-f
BcR
CAAGAAATCTTACCAGTATTA TTCACTACTAATGTAGCTAACG Bacillus cereus cpn60 This study
Bs-f
Bs-R
GACAATCCTTACATCTTAATCAC AACAAGTGTTGCAAGTGCTT Bacillus subtilis cpn60 This study
Brev-f
Brev-R
CTGGAGCAAGTTGTACAAAGC CAGCAACAGCTGTGAAGGTA Brevibacillus choshinensis cpn60 This study
Ab-F
Ab-R
CATTCGTGAATTGATTTCTGT CATGTTGTTTACAACAAGAGT Acinetobacter baumannii cpn60 This study

aGC clamp sequence: GCGGGCGGGGCGGGGGCACGGGGGGCGCGGCGGGCGGGGCGGGGG
Table 1: Primer sequences.