FORWARD

REVERSE

Ex 6A

TTTATCAACTGCTGAAGCCCC

ATAGTCCTCCCTCTCCCCAAC

Ex 10

CTGAACCTAGAGCCCTGTGGG

AGACAGAGTCCCAGAGTGAGG

Ex 16A

TGGAAACCAGAGTGCCTGAG

TGATCCTGCAGCATCTGCAG

Ex 24

GCACCTCCCAACATTGAC

GAACCAGGTCTGGGTGT

Ex 25

TCACTAGTCCTCAGGAGGT

CTGCCTGGCTCTCTGGGA

Table 1: Primers self-designed for TCOF1 gene amplification and sequencing.